Skip to main content

Correction to: LncRNA-NEAT1 from the competing endogenous RNA network promotes cardioprotective efficacy of mesenchymal stem cell-derived exosomes induced by macrophage migration inhibitory factor via the miR-142-3p/FOXO1 signaling pathway

The Original Article was published on 21 January 2020

Correction to: Stem Cell Res Ther 11, 31 (2020)

https://doi.org/10.1186/s13287-020-1556-7

Following publication of the original article [1], the authors identified an error in Table 1. The primer of human LncRNA-NEAT1 should be revised to F: 5′ - GTGGCTGTTGGAGTCGGTAT − 3′ and R: 5′ - ACCACGGTCCATGAAGCATT − 3′.

Table 1 Primer sequences

The correct table has been included in this correction.

Reference

  1. Chen H, et al. LncRNA-NEAT1 from the competing endogenous RNA network promotes cardioprotective efficacy of mesenchymal stem cell-derived exosomes induced by macrophage migration inhibitory factor via the miR-142-3p/FOXO1 signaling pathway. Stem Cell Res Ther. 2020;11:31. https://doi.org/10.1186/s13287-020-1556-7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Meng Hou.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Chen, H., Xia, W. & Hou, M. Correction to: LncRNA-NEAT1 from the competing endogenous RNA network promotes cardioprotective efficacy of mesenchymal stem cell-derived exosomes induced by macrophage migration inhibitory factor via the miR-142-3p/FOXO1 signaling pathway. Stem Cell Res Ther 11, 376 (2020). https://doi.org/10.1186/s13287-020-01898-y

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s13287-020-01898-y