Skip to main content

Table 1 Primer sequences

From: A barrier against reactive oxygen species: chitosan/acellular dermal matrix scaffold enhances stem cell retention and improves cutaneous wound healing

Gene Forward primer (5′–> 3′) Reverse primer (5′–> 3′)
β-actin CGTTGACATCCGTAAAGACC TAGGAGCCAGAGCAGTAATC
GFP GCACGACTTCTTCAAGTCCGCCATGCC GCGGATCTTGAAGTTCACCTTGATGCC
LPL AGTTTGACCGCCTTCCGCGG TCCTGTCACCGTCCATCCATGGA
PPARγ ACTGCCGGATCCACAAAA TCTCCTTCTCGGCCTGTG
ALP AACCCAGACACAAGCATTCC CCAGCAAGAAGAAGCCTTTTG
Runx-2 TGCCACCTCTGACTTCTGCC CGCTCCGGCCCACAATCTC