Skip to main content

Table 1 Sense and antisense primers for real-time reverse transcription polymerase chain reaction

From: Circular RNA SIPA1L1 regulates osteoblastic differentiation of stem cells from apical papilla via miR-204-5p/ALPL pathway

Genes Primers Sequences (5′-3′)
ALPL Forward ACCTGAGTGCCAGAGTGA
Reverse CTTCCTCCTTGTTGGGTT
RUNX2 Forward TCTTAGAACAAATTCTGCCCTTT
Reverse TGCTTTGGTCTTGAAATCACA
OSX Forward CCTCCTCAGCTCACCTTCTC
Reverse GTTGGGAGCCCAAATAGAAA
circSIPA1L1 Forward AAACTGGATGAACAAGGGAGAA
Reverse TGCTTCACTTTAACAGAGGGCTT
GAPDH Forward GAAGGTGAAGGTCGGAGTC
Reverse GAGATGGTGATGGGATTTC