Skip to main content

Table 1 qPCR primer sequences

From: RNA-seq reveals tight junction-relevant erythropoietic fate induced by OCT4 in human hair follicle mesenchymal stem cells

Gene Forward primer Reverse primer
TJP1 CAACATACAGTGACGCTTCACA CACTATTGACGTTTCCCCACTC
TJP2 TTTCCCGACACCCCAAAGTAG CACCCTGCTTCCTTGAGACC
TJP3 AGCTACAAGCCTCGGGTTCC GCTGTTCCCAGATGGTCAGC
JAM1 ATGGGGACAAAGGCGCAAG CAATGCCAGGGAGCACAACA
JAM3 TCCAGCAATCGAACCCCAG CTTGTCTGCGAATCCGTAATGAT
CLDN5 CTCTGCTGGTTCGCCAACAT CAGCTCGTACTTCTGCGACA
CLDN6 TGTTCGGCTTGCTGGTCTAC CGGGGATTAGCGTCAGGAC
CLDN7 AGTTAGGAGCCTTGATGCCG GCACAGGGAGTAGGATACGC
CLDN11 CATTGCCAGTTGACTGCCTG ATCCGGATGCAGGGAAGAAC
ACTN2 GACATCGTGAACACCCCTAAAC CCGCAAAAGCGTGGTAGAA
E-cadherin ACCACGGGCTTGGATTTTGA GGAGGTGGTGAGAGAGACCT
ROCK1 AAGTGAGGTTAGGGCGAAATG AAGGTAGTTGATTGCCAACGAA
RUNX1 GTGGGTACGAAGGAAATGACTCAAA GCAGCGTGGTAAAAGAAATCATTGAG
GAPDH CCATGTTCGTCATGGGTGTGA CATGGACTGTGGTCATGAGT