Skip to main content

Table 1 Primer sequence information

From: Human embryonic stem cell-derived extracellular vesicles alleviate retinal degeneration by upregulating Oct4 to promote retinal Müller cell retrodifferentiation via HSP90

Name of primer Sequences (5′-3′)
HSP90-F CCTCAAGTCCACGCATCCAG
HSP90-R TCGCCTCCTTGTGCATCTTC
Oct4-F CAGGGTTTTTGGGATTAAGTTCT
Oct4-R TGTGTCCCAGGCTTCTTTATTTA
GAPDH-F ACCACAGTCCATGCCATCAC
GAPDH-R TCCACCACCCTGTTGCTGTA
  1. F forward primer, R reversed primer