Skip to main content

Table 1 Primers used for RT-PCR

From: Single-cell RNA sequencing of equine mesenchymal stromal cells from primary donor-matched tissue sources reveals functional heterogeneity in immune modulation and cell motility

Gene Product Abbreviation Forward primer (5′-3′) Reverse primer (5′-3′)
junctional adhesion molecule 2 JAM2 AAAGTTGGCTCCCAAAGCAC ACACTTGCGATGTCCAACAG
C-X-C motif chemokine ligand 6 CXCL6 AGAGAACT GCGTTGCATGTG TCAAGGTGGCTACGACTTCC
adrenomedullin ADM TCCCGTAACCCTCATGTACC AAGTTCCCTCTTCCCACGAC
insulin-like growth factor binding protein 5 IGFBP5 CTCATTATTCCGGTGGTTGC GTGGAGGCTGGAGAGACAAG
monoglyceride lipase MGLL AAAGGAGCCTACTTGCTCATGG TTTCACGGAAGACGGAGTTG
asporin ASPN AAACCCTTGCTTCACCCTTC TCAGCGTCACTGTCACCTTC
cellular retinoic acid binding protein 2 CRABP2 CCTGGTGAAATGGGAAAGTG TGTCGTCCGCTGTCATAGTC
beta-2-microglobulin B2M TCTTTCAGCAAGGACTGGTCTTT CATCCACACCATTGGGAGTAAA