Skip to main content

Table 1 Primers for the selected genes

From: Intramuscular injection of Botox causes tendon atrophy by induction of senescence of tendon-derived stem cells

Gene Primer sequence
Forward 5′- > 3′ Reverse 5′- > 3′
ALP GAAGCTCTGGGTGCAGGATAG GGACCGTCCACTGTCACTTT
BMP2 CCCCAAGACACAGTTCCCTA GAGACCGCAGTCCGTCTAAG
RUNX2 GCCGGGAATGATGAGAACTA GGACCGTCCACTGTCACTTT
Aggrecan AAGGACGAGTTCCCTGGAGT CTGGGGATGTCGCATAAAAG
SOX9 AGCTCACCAGACCCTGAGAA TCCCAGCAATCGTTACCTTC
Scleraxis CCCAAACAGATCTGCACCTT GGCTCTCCGTGACTCTTCGA
Tenomodulin AGAATGAGCAATGGGTGGTC CTCGACCTCCTTGGTAGCAG
MKX CTGGACAATCCACACACAGG TCTTCGTAGGGTACGGGTTG
36B4 CTTCCCACTTGCTGAAAAGG CGAAGAGACCGAATCCCATA