Skip to main content

Table 1 Primers used for qPCR amplification

From: The therapeutic efficacy of mesenchymal stromal cells on experimental colitis was improved by the IFN-γ and poly(I:C) priming through promoting the expression of indoleamine 2,3-dioxygenase

Gene Forward sequence (5′-3′) Reverse sequence (5′-3′)
Lgr5 ACCCGCCAGTCTCCTACATC GCATCTAGGCGCAGGGATTG
OLFM4 TGGCCCTTGGAAGCTGTAGT ACCTCCTTGGCCATAGCGAA
Bmi1 GCCACTACCATAATAGAATGTCT TTGTGAACCTGGACATCACAAA
Axin2 GCAAACTTTCGCCAACCGTG CTCTGGAGCTGTTTCTTACTGCCC
Muc2 GCTGACGAGTGGTTGGTGAATG GATGAGGTGGCAGACAGGAGAC
Alpi GGCTACACACTTAGGGGGACCTCCA AGCTTCGGTGACATTGGGCCGGTT
Chga AGGTGATGAAGTGCGTCCTG GGTGTCGCAGGATAGAGAGGA
Occludin GGACCCTGACCACTATGAAACAGACTAC ATAGGTGGATATTCCCTGACCCAGTC
IL-1β GCAACTGTTCCTGAACTCAAC ATCTTTTGGGGTCCGTCAACT
TNF-α GGAACACGTCGTGGGATAATG GGCAGACTTTGGATGCTTCTT
IL-6 TCCATCCAGTTGCCTTCTTG GGTCTGTTGGGAGTGGTATC
MCP-1 CTCACCTGCTGCTACTCATTC GCTTGAGGTGGTTGTGGAAAA
Foxp3 ACAACCTGAGCCTGCACAAGTT GCCCACCTTTTCTTGGTTTTG
IL-10 AGGGCCCTTTGCTATGGTGT TGGCCACAGTTTTCAGGGAT
IDO1 ATTGGTGGAAATCGCAGCTTC ACAAAGTCACGCATCCTCTTAAA
COX2 CCAGCACTTCACCCATCAGTT ACCCAGGTCCTCGCTTATGA
PTEGS3 ATCACATGGGTGGTGATGAGGA AGGCGATGACAACAGCCCTTAC
β-actin AGCTGCGTTTTACACCCTTT AAGCCATGCCAATGTTGTCT
  1. Lgr5 leucine-rich repeat-containing G protein-coupled receptor 5; OLFM4 olfactomedin 4; Bmi1 B cell-specific Moloney murine leukemia virus integration site 1; Axin2 axis inhibition protein 2; Muc2 mucin 2; Alpi alkaline phosphatase, intestinal; Chga chromogranin A; IL-1β interleukin 1 beta; TNF-α tumor necrosis factor alpha; IL-6 interleukin 6; MCP-1 monocyte chemoattractant protein 1; Foxp3 forkhead box P3; IL-10 interleukin 10; IDO1 indoleamine 2,3-dioxygenase; COX2 cyclooxygenase-2; PTEGS3 prostaglandin E synthase 3