Skip to main content

Table 2 PCR primers information

From: Bleomycin induces fibrotic transformation of bone marrow stromal cells to treat height loss of intervertebral disc through the TGFβR1/Smad2/3 pathway

Gene Accession number Description 5′-primer-3′
Fn1 NM_019143.2 F
R
GGATCCCCTCCCAGAGAAGT
GGGTGTGGAAGGGTAACCAG
Col1a1 NM_053304.1 F
R
GGATCGACCCTAACCAAGGC
GATCGGAACCTTCGCTTCCA
Col3a1 NM_032085.1 F
R
AGTGGCCATAATGGGGAACG
CACCTTTGTCACCTCGTGGA
TGFβR1 NM_012775.2 F
R
TGCCTGCTTCTCATCGTGTT
TGCTTTTCTGTAGTTGGGAGT
TGFβR2 NM_031132.3 F
R
CCAAGTCGGTTAACAGCGAT
TGAAGCCGTGGTAGGTGAAC
TGFβR3 NM_017256.1 F
R
GAGGGGCTGTCACTTACCAC
CTAATCCCCTCGCTGACCAC
TGFβ1 NM_021578.2 F
R
CACTCCCGTGGCTTCTAGTG
GGACTGGCGAGCCTTAGTTT
MMP3 NM_133523.3 F
R
TTTGGCCGTCTCTTCCATCC
GCATCGATCTTCTGGACGGT
MMP13 NM_133530.1 F
R
TGCTGCATACGAGCATCCAT
TGTCCTCAAAGTGAACCGCA
Timp1 NM_012886.2 F
R
AAATACCTTCCTGGTCCCGC
TAGGAGACTCTGGCGTCTGT
P21 NM_017198.1 F
R
TCCTCTCGGCTATTACCGGC
GGTGTTTCTCATCGGAGGGG
CDK1 NM_019296.1 F
R
GGAACAGAGAGGGTCCGTTG
GCACTCCTTCTTCCTCGCTT
CDK2 NM_199501.1 F
R
TGCTTATCAACGCAGAGGGG
GGGTCACCATTTCGGCAAAG
CDK4 NM_053593.2 F
R
GGACCGATCCCCGGTGTA
TCAGGTCCCGGTGAACAATG
CDK6 NM_001191861.1 F
R
TCGTGGAAGTTCAGACGTGG
CGACAGGTGAGAATGCAGGT
CCNG2 NM_001105725.2 F
R
ACCTGTGTGAAAGCGGAACA
TGGCACCCATGTACAACACA
CCND2 NM_022267.1 F
R
GATGATCGCAACTGGAAGCG
TGGTCCGGATCTTCCACAGA