Skip to main content

Table 1 Primers used for quantitative real-time reverse transcription polymerase chain reaction

From: Human amnion-derived mesenchymal stem cells promote osteogenic differentiation of lipopolysaccharide-induced human bone marrow mesenchymal stem cells via ANRIL/miR-125a/APC axis

Genes Sense primer(5′-3′) Anti-sense primer(5′-3′)
ALP AGAACCCAAAGGCTTCTTC CTTGGCTTTTCCTTCATGGT
RUNX2 TCTTAGAACAAATTCTGCCCTTT TGCTTTGGTCTTGAAATCACA
OCN AGCAAAGGTGCAGCCTTTGT GCGCCTGGGTCTCTTCACT
OSX CCTCCTCAGCTCACCTTCTC GTTGGGAGCCCAAATAGAAA
ANRIL CCCTAGCTACATCCGTCACCTGA CCACAGCTACATATGCGTTTACA
APC AAAGTGAGCAGCTACCACG CCTGGAGTGATCTGTTAGTCG
훽-Catenin AGCTGACAACTTTCACACC AATGGGGATGTTGATCTTC