Skip to main content

Table 2 Primers used for amplification of horse intra-MHC microsatellites

From: Allo-antibody production after intraarticular administration of mesenchymal stem cells (MSCs) in an equine osteoarthritis model: effect of repeated administration, MSC inflammatory stimulation, and equine leukocyte antigen (ELA) compatibility

 LocusDyePrimer sequenceAllele range (bp)Reference
MHC Class IUMNJH-38F′FAMTGTGTGTGCACCTGTCCTTT156–165Sadeghi et al., 2018 [18]
R′ GATGGGAGGGAATGAGGAAT
COR110F′ TTTGGTCTTTGCAGGTATGG194–221Tseng et al., 2010 [19]
R′VICTCTCCCTTCCTCTTTGTTCC
MHC Class IIIABGe 9019F′FAMCTGAGAGAGACAGCATTTGTGG297–320Sadeghi et al., 2018 [18]
R′ GAAAGGTGTCTCCATTCTTGCT
UNMe65F′AT550 (NED)TCGCAAAACCCACAGACTAC247–269Sadeghi et al., 2018 [18]
R′ TTCTCCTTTCCTTCCACTCC
MHC Class IIABGe 9030F′AT565 (PET)CCAGCAGACCTGCAAGAGTA205–221Sadeghi et al., 2018 [18]
R′ AGCATGAGAGCCATGAAGGT
EQMHC1F′AT532 (VIC)ATGCATACCGGGAAAGACAG180–196Sadeghi et al., 2018 [18]
R′ AGAGACTTCAGTCTCTGTGGTG
COR112F′ TTACCTGGTTATTGGTTATTTGG236–268Tseng et al., 2010 [19]
R′NEDTCACCCACTAAATCTCAAATCC
COR113F′ TGTTTAGAACTCGCCAGGAG260–276Tseng et al., 2010 [19]
R′FAMTCATCAGTTCCTTGCCTAGC
UM011F′ TGAAAGTAGAAAGGGATGTGG165–180Tseng et al., 2010 [19]
R′FAMTCTCAGAGCAGAAGTCCCTG
COR114F′ TCAAAATCCACACTCCCTTC234–255Tseng et al., 2010 [19]
R’PETTCCATAAAGAGTGGGACACTG
  1. Primers (F′, forward; R′, reverse), dye, sequence, allele range (base pair) and reference