Skip to main content

Table 1 Sequences of transfection primers

From: MicroRNA-495 confers inhibitory effects on cancer stem cells in oral squamous cell carcinoma through the HOXC6-mediated TGF-β signaling pathway

GroupsPrimer sequences (5′-3′)
siRNA-NCUUCUUCUAACUUUUCACGUUC
miR-495 mimicAAAGAACACTTTTCGGTATT
miR-495 inhibitorAATACCGAAAAGTGTTCTTT
siRNA-HOXC6UUUAAUAUUUAUUUCUGUCUC
  1. siRNA small interfering RNA, HOXC6 homeobox C6, NC negative control, miR-495 microRNA-495