Skip to main content

Table 1 Primers sequences used for RT-qPCR analysis

From: Combined macromolecule biomaterials together with fluid shear stress promote the osteogenic differentiation capacity of equine adipose-derived mesenchymal stem cells

Gene Forward Reverse Size (bp)
GAPDH CCAGCAAGAGAAGGAGAAAGG AACTGTGGAGGTCAGGAGAC 93
Runx2 ACCGACAGCCCCAACTTC ACCCGCCATGACAGTAACC 132
ALP GACTGGTACTCGGACAACGAG GTTCTTGGGGAACATGTACTTC 137