Skip to main content

Table 2 Primer sequences for qPCR amplification of specific genes

From: JKAMP inhibits the osteogenic capacity of adipose-derived stem cells in diabetic osteoporosis by modulating the Wnt signaling pathway through intragenic DNA methylation

Genes Sequence (5′ → 3′)
Gapdh Forward GGTGAAGGTCGGTGTGAACG
Reverse CTCGCTCCTGGAAGATGGTG
Jkamp Forward CCAATGGCTGTCGATATTCAACC
Reverse CTTGGGCATACCCCACATTCT
Jnk1 Forward GTGGAATCAAGCACCTTCACT
Reverse TCCTCGCCAGTCCAAAATCAA
β-Catenin Forward GCTGCGTGGACAATGGCTACTC
Reverse AGCGTCAAACTGCGTGGATGG
Runx2 Forward GACTGTGGTTACCGTCATGGC
Reverse ACTTGGTTTTTCATAACAGCGGA
Opn Forward TCCCTCCCGGTGAAAGTGACTG
Reverse TCCTCGCTCTCTGCATGGTCTC