Skip to main content

Table 3 List of primers for quantitative reverse transcription-polymerase chain reaction

From: Endometrial regeneration with endometrial epithelium: homologous orchestration with endometrial stroma as a feeder

Gene Primer sequence
PRL Forward 5′ TCATCTGGTCACGGAAGTACGT 3′
Reverse 5′ GCCCTCTAGAAGCCGTTTGG 3′
IGFBP1 Forward 5′ ATGGCTCGAAGGCTCTCCAT 3′
Reverse 5′ TCCTGTGCCTTGGCTAAACTC 3′
GAPDH Forward 5′ TGTTGCCATCAATGACCCCTT 3′
Reverse 5′ CTCCACGACGTACTCAGCG 3′
  1. PRL prolactin, IGFBP1 insulin-like growth factor binding protein 1, GAPDH glyceraldehyde 3-phosphate dehydrogenase