Skip to main content

Table 1 Primer sequences used in RT-PCR

From: mTOR inhibitor INK128 promotes wound healing by regulating MDSCs

Gene Forward primers Reverse primers
GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA
p47phox ACACCTTCATTCGCCATATTGC CCTGCCACTTAACCAGGAACA
gp91phox AGTGCGTGTTGCTCGACAA GCGGTGTGCAGTGCTATCAT
Arg-1 CTCCAAGCCAAAGTCCTTAGAG GGAGCTGTCATTAGGGACATCA
iNOS GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC
IL-6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG
CD206 CTCTGTTCAGCTATTGGACGC TGGCACTCCCAAACATAATTTGA
IL-10 CTTACTGACTGGCATGAGGATCA GCAGCTCTAGGAGCATGTGG
IGF-1 CACATCATGTCGTCTTCACACC GGAAGCAACACTCATCCACAATG
IL-1β GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG
S100A8 AAATCACCATGCCCTCTACAAG CCCACTTTTATCACCATCGCAA
S100A9 GCACAGTTGGCAACCTTTATG TGATTGTCCTGGTTTGTGTCC