Skip to main content

Table 1 Sequences of primers used for quantitative PCR

From: Melatonin promotes bone marrow mesenchymal stem cell osteogenic differentiation and prevents osteoporosis development through modulating circ_0003865 that sponges miR-3653-3p

Primer name Primer sequences (5′–3′)
RUNX2 F AGAAGGCACAGACAGAAGCTTGA
RUNX2 R AGGAATGCGCCCTAAATCACT
OPN F GCGAGGAGTTGAATGGTG
OPN R GCGAGGAGTTGAATGGTG
ALP F GAGTCGGACGTGTACCGGA
ALP R TGCCACTCCCACATTTGTCAC
hsa_circ_0002770-CF1 TGTATCAGGCAGGGGAGAGT
hsa_circ_0002770-CR1 ACACAGAGCCAGGCTTTCAT
hsa_circ_0073244-CF1 CTGGACAAGCAAGGCAAAGT
hsa_circ_0073244-CR1 CTTGGCTCCTTGGGTAATCA
hsa_circ_0003126-CF1 CAAAGCAGTGGGCTCACATA
hsa_circ_0003126-CR1 GGCCTCCAATTCATTCAGTC
hsa_circ_0002867-CF1 ACAGTCCGCAATGCCTTAAA
hsa_circ_0002867-CR1 TTCAAGAGAGCCGTCCAACT
hsa_circ_0008210-CF1 GCTGCATCAAGAAACCCAAG
hsa_circ_0008210-CR1 CAGTTGCTCCACATCTCTGC
hsa_circ_0037026-CF1 CCATTCTCATGCCTTGGTCT
hsa_circ_0037026-CR1 TGGCAGCACTCATTGTTCTC
hsa_circ_0005015-CF1 AGAGCACTGGGACGAAGTGT
hsa_circ_0005015-CR1 AAGCAGCTGTGATTCCAAGG
hsa_circ_0006935-CF1 CCCTGAGTTGGTGCTGAAA
hsa_circ_0006935-CR1 ATGATGGGCTTGGTAGGTGA
hsa_circ_0003865-CF1 ACTTCGTCACGGTGGAAATC
hsa_circ_0003865-CR1 CCCCCAATTTTCACTTGTATG
hsa_circ_0003865-LF1 CAACGCCTGCCCAAAAGAAA
hsa_circ_0003865-LR1 AGTGGTGTCCAACCTGCAAA
H-GAPDH-conver-F GAGTCAACGGATTTGGTCGT
H-GAPDH-conver-R GACAAGCTTCCCGTTCTCAG
H-GAPDH-diver-F TCTGACTTCAACAGCGACAC
H-GAPDH-diver-R TGACGGTGCCATGGAATTTG
hsa-miR-3653-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTTCAG
hsa-miR-3653-3p-F CTAAGAAGTTGACTGAAG
hsa-miR-4775-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGTGAC
hsa-miR-4775-F TTAATTTTTTGTTTCGGTCACT
hsa-miR-511-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGACTG
hsa-miR-511-5p-F GTGTCTTTTGCTCTGCAGTCA
hsa-miR-6509-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATTA
hsa-miR-6509-3p-F TTCCACTGCCACTACCTAATTT
hsa-miR-942-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACATG
hsa-miR-942-5p-F TCTTCTCTGTTTTGGCCATGTG
Universe-R GTGCAGGGTCCGAGGT
GAS1-F GACCTACTGCGGCAAAGTCT
GAS1-R GCCATGTTCTCCTTGACCGA
SFRP2-F GACCATTTCTGCTCCGGGAT
SFRP2-R CAGCTATCCACTCCTGTGGC
hsa-U6-F CTCGCTTCGGCAGCACA
hsa-U6-R AACGCTTCACGAATTTGCGT