Skip to main content

Table 1 Primer sequences used for RT-PCR gene expression analysis

From: Improvement of ECM-based bioroot regeneration via N-acetylcysteine-induced antioxidative effects

Target cDNA Primer sequence (5′-3′)
Gapdh CTTTGGTATCGTGGAAGGACTC
GTAGAGGCAGGGATGATGTTCT
ALP TAAGGACATCGCCTACCAGCTC
TCTTCCAGGTGTCAACGAGGT
COL1 AACATGGAGACTGGTGAGACCT
CGCCATACTCGAACTGGAATC
RunX2 CTTTACTTACACCCCGCCAGTC
AGAGATATGGAGTGCTGCTGGTC
Periostin CACTCTTTGCTCCCACCAATA
ATTTCCTTCCAGCGTCTCAA