Skip to main content

Table 1 The primer sequences of genes in this experiment

From: Morusin induces osteogenic differentiation of bone marrow mesenchymal stem cells by canonical Wnt/β-catenin pathway and prevents bone loss in an ovariectomized rat model

Target genes Forward primer Reverse primer
COL1A1 TGTCGTTCAACGGCACAG TGTGGTAGACTCCACGACA
RUNX2 GAGCGTTCAACGGCACAG GACAGTAGACTCCACGACA
BSP CGTCTCCATGGTGGATTATG GGATGTAGTTCTGCTCATGG
OCN GTCAGACTACAACATCCAGAAG CGAGTATCTTCCTGTTTGACC
β-catenin GCCATCACCACGCTGCATAATCT GGCAGTCTGTCGTAATAGCCAAGAA
Dvl-1 CCTTCCATCCAAATGTTGCCAGTA GGGCAGCCTCATCACGGTTT
LEF-1 CACACAACTGGCATCCCTCATC GCTCCTGTTCCTTTCTCTCTGTTCGT
GAPDH GGGTGTGAACCACGAGAAAT ACTGTGGTCATGAGCCCTTC
  1. COL1A1 collagen type I alpha 1, RUNX2 runt-related transcription factor 2, BSP bone sialoprotein, OCN osteocalcin, Dvl-1 dishevelled-1, LEF-1 lymphoid enhancing factor-1, GAPDH glyceraldehyde phosphate dehydrogenase