Skip to main content

Table 1 Primer sequences used for real-time PCR

From: Ultrasound enhances the therapeutic potential of mesenchymal stem cells wrapped in greater omentum for aristolochic acid nephropathy

Gene Forward sequence (5′ → 3′) Reverse sequence (5′ → 3′)
Mouse TNF-alpha GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG
Mouse IL-1β TGGACCTTCCAGGATGAGGACA GTTCATCTCGGAGCCTGTAGTG
Mouse FN CCCTATCTCTGATACCGTTGTCC TGCCGCAACTACTGTGATTCGG
Mouse Col-I CCTCAGGGTATTGCTGGACAAC CAGAAGGACCTTGTTTGCCAGG
Mouse IL-6 TACCACTTCACAAGTCGGAGGC CTGCAAGTGCATCATCGTTGTTC