Skip to main content

Table 1 qRT-PCR Forward/Reverse(F/R) primers sequences

From: Repair abilities of mouse autologous adipose-derived stem cells and ShakeGel™3D complex local injection with intrauterine adhesion by BMP7-Smad5 signaling pathway activation

Primers Sequences 5′-3′
a-SMA F: 5′- GCGTGGCTATTCCTTCGTGACTAC -3′
R: 5′- CGTCAGGCAGTTCGTAGCTCTTC -3′
TGF-β1 F: 5′- CCAGATCCTGTCCAAACTAAGG -3′
R: 5′- CTCTTTAGCATAGTAGTCCGCT -3′
BMP7 F: 5′- GATCCTGTCCATCTTAGGGTTG -3′
R: 5′- GTTGTACAGGTCCAACATGAAC -3′
Smad5 F: 5′- TTTCCCCTTATCTCCTAACAGC -3′
R: 5′- TACTGCTTGTATCCATAGGCTG -3′
GAPDH F: 5′- TGGGTGTGAACCATGAGAAG-3′
R: 5′- GCTAAGCAGTTGGTGGTGC-3′
  1. a-SMA a-smooth muscle actin, TGF-β1 transforming growth factor beta receptor I, BMP7 bone morphogenetic protein 7, Smad5 SMAD family member 5, GAPDH glyceraldehyde-3-phosphate dehydrogenase