Skip to main content

Table 2 Primer sequences for quantitative reverse transcription transcription-polymerase chain reaction

From: Transplantation of human induced pluripotent stem cell-derived neural crest cells for corneal endothelial regeneration

Gene name Forward Reverse
Human NANOG TGGGCCTGAAGAAAACTATCCAT GAAGTGGGTTGTTTGCCTTTG
Human OCT4 CCCGAAAGAGAAAGCGAACC CCACACTCGGACCACATCC
Human SOX2 ACCCCTGGCATGGCTCTT ATGCTGATCATGTCCCGGA
Human P75 CGACAACCTCATCCCTGTCTAT CCACTGTCGCTGTGGAGTTTT
Human TFAP2B CCGCCAAAGCCGTCTCT TGGGTCGGCTGTTCCCT
Human TFAP2A CCTGTCCAAGTCCAACAGCAAT GACACTCGGGTGGTGAGAGC
Human SOX9 CCCCAACAGATCGCCTACAG TCTGGTGGTCGGTGTAGTCGT
Human SOX10 CGCACCTGCACAACGCT GCGGCCTTCCCGTTCTT
Human ZO-1 AGGATCCATATCCCGAGGAAA CGAGGTCTCTGCTGGCTTGT
Human Na+/K+ATPase CAGGGCAGTGTTTCAGGCTAA TCGACGATTTTGGCGTATCTT
Human SLC4A11 GGACATCGCACGCAGGTT CGTCATTGAGAGACCCGAAAG
Human AQP1 CCTCCAGCTGGTGCTATGC AAGGACCGAGCAGGGTTAATC
Human N-cadherin ATCCGACGAATGGATGAAAGA ACTAACAGGGAGTCATATGGTGGA
Human COL8A2 CCGGCCACCTATACCTACGAT TCCTGAAAAGGAGGAGTGGATGTA
Human P21 GACAGCAGAGGAAGACCATGTG GGCGTTTGGAGTGGTAGAAATC
Human P16 TGCCCAACGCACCGAATA GCACGGGTCGGGTGAGA
Human α-SMA CAGAGACCCTGTTCCAGCCA GCCCCCTGATAGGACATTGTTA
Human SNAIL2 GCGATGCCCAGTCTAGAAAATCT CTTCTCCCCCGTGTGAGTTCTA
Human GAPDGH CATGTTCGTCATGGGTGTGAA CATGGACTGTGGTCATGAGTCCT