Skip to main content

Table 1 Sequences of primers used in real-time PCR

From: The adipose-derived mesenchymal stem cell secretome promotes hepatic regeneration in miniature pigs after liver ischaemia-reperfusion combined with partial resection

Gene Forward primer (5′- > 3′) Reverse primer (5′- > 3′)
HGF TGATCAACTCAGACGGCCTA AGCCCCAGCACATATTTCAG
CyclinD1 AAGTGCGTGCAGAAGGAAAT AGGAAGCGGTCCAGGTAGTT
TGF-β CCATTCGCGGCCAGATT GCTCCGGTTCGACACTTTC
β-actin TCTGGCACCACACCTTCT TGATCTGGGTCATCTTCTCAC