Skip to main content

Table 1 Primers used for RT-PCR

From: Therapeutic potential of small extracellular vesicles derived from lipoma tissue in adipose tissue regeneration—an in vitro and in vivo study

Gene Primers
PPARγ2 5′-GCCCTTTGGTGACTTTATGGAG-3′
GCAGCAGGTTGTCTTGGATGT
C/EBP-δ CTGCCATGTATGACGACGAGAG
CGCTTTGTGATTGCTGTTGAAG
ADIPONECTIN CGTTCTCTTCACCTACGACCAGT
ATTGTTGTCCCCTTCCCCATAC
GAPDH TCAACGGCACAGTCAAGG
ACCAGTGGATGCAGGGAT