Skip to main content

Table 2 Specific primers used in this study

From: Sinusoidal electromagnetic fields accelerate bone regeneration by boosting the multifunctionality of bone marrow mesenchymal stem cells

Gene (mouse)   Primer sequences
IL-1 Forward:
Reverse:
CCTGGACTGTGAGCATGGATA
GTAAGGGGCGTCATCAGGAC
IL-6 Forward:
Reverse:
GGTGCCCTGCCAGTATTCTC
GGCTCCCAACACAGGATGA
CD206 Forward:
Reverse:
CTCTGCCATCACGTTTAGTGAA
GACGGTTATCAAAACAACGCC
PDGFB Forward:
Reverse:
CATCCGCTCCTTTGATGATCTT
GTGCTCGGGTCATGTTCAAGT
VEGFA Forward:
Reverse:
CCACCTGCAAGACCATCGAC
CTGGCGAGCCTTAGTTTGGAC
TGF-β Forward:
Reverse:
TATTCAGCGGACTCACCAGC
AACCAACCTCCTCAAACCGT
GAPDH Forward:
Reverse:
TTCCAGGAGCGAGACCCCACTA
GGGCGGAGATGATGACCCTTTT