Skip to main content

Table 1 Human primer sequences using quantitative real time polymerase chain reaction

From: PRL-1 overexpressed placenta-derived mesenchymal stem cells suppress adipogenesis in Graves’ ophthalmopathy through SREBP2/HMGCR pathway

Genes   Primer sequences Tm
Adipsin Forward 5′-GGGCAGCGTGTACTTATCCT-3′ 55
Reverse 5′- AGAACCCCAAGATGCACAAC -3′
PPAR-γ Forward 5′- GCGGCTACTACAACCAGAGC -3′ 55
Reverse 5′- GCACATGGCACGTGTATCTC -3′
Adiponectin Forward 5′-GAGCTGACGTGGAAGATGAG-3′ 55
Reverse 5′-CTTCAAGTGCTGTCTGATTCCAATG-3′
Leptin Forward 5′-ATGCTGCAAACTGACCACGC-3′ 55
Reverse 5′-GCTTCGCTTTGCCAATGCTT-3′
LPL Forward 5′-TGAGTTTGCAGAAGTTTCCA-3′ 60
Reverse 5′-CCTTTGCCTCAGCATAGTTT-3′
FABP4 Forward 5′-GCATGGCCAAACCTAACATGA-3′ 55
Reverse 5′-CCTGGCCCAGTATGAAGGAAA-3′
C/EBPα Forward 5′-TGTATACCCCTGGTGGGAGA-3′ 60
Reverse 5′-TCATAACTCCGGTCCCTCTG-3′
C/EBPβ Forward 5′-CTTCAGCCCGTACCTGGAG-3′ 60
Reverse 5′-GGAGAAGGAAGTCGTGGTGC-3′
TSHR Forward 5′-GACACTGAAGCTGTACAACAATGG-3′ 60
Reverse 5′-AGACACGTCCAGCAAGCTTGGT-3′
SREBP2 Forward 5′-CAAGGCCCTGGAAGTGACAGA-3′ 60
Reverse 5′-AGGAACTCTGCTGCCCATCTG-3′
HMGCR Forward 5′-GCCTGGCTCGAAACATCTGAA-3′ 60
Reverse 5′-CTGACCTGGACTGGAAACGGATA-3′
ICAM-1 Forward 5′-CAGTCACCTATGGCAACGACTC-3′ 60
Reverse 5′-CTCTGGCTTCGTCAGAATCAC-3′
IL-1β Forward 5′-ATGAGTGCTCCTTCCAGGA-3′ 60
Reverse 5′-GATAGGTTCTTCAAAGATG-3′
TNF-α Forward 5′-CCAGAGGGAAGAGTTCCCCA-3′ 55
Reverse 5′-TCAGCTTGAGGGTTTGCTACAAC-3′
IL-6 Forward 5′-TCCACAAGCGCCTTCGGTCCAGTTG-3′ 55
Reverse 5′-AGAGGTGAGTGGCTGTCTGTGTGGG-3′
TGF-β1 Forward 5′-TACCAGAAATACAGCAACAATTCC-3′ 55
Reverse 5′-AAAGCCCTCAATTTCCCCTCC-3′
TGF-β2 Forward 5′-TGGTGAAAGCAGAGTTCAGAG-3′ 55
Reverse 5′-CACAACTTTGCTGTCGATGTAG-3′
GAPDH Forward 5′-TCCTTCTGCATCCTGTCAGCA-3′ 60
Reverse 5′-CAGGAGATGGCCACTGCCGCA-3′