Skip to main content

Table 1 Primers for RT-qPCR

From: MiR-34a suppression targets Nampt to ameliorate bone marrow mesenchymal stem cell senescence by regulating NAD+-Sirt1 pathway

Gene Forward primers (5′-3′) Reverse primers (3′-5′)
Nampt AGGGGCATCTGCTCATTTGG TGGTACTGTGCTCTGCCGCT
pl6INK4 AAACACTTTCGGTCGTACCC GTCCTCGCAGTTCGAATC
p21WAF1/CIP GACATCACCAGGATCGGACAT GCAACGCTACTACGCAAGTAG
β-actin GGAGATTACTGCCCTGGCTCCTA GACTCATCGTACTCCTGCTTGCTG
snRNA U6 RmiRQP9003 GeneCopoeia, China  
rno-miR-34a-5p RmiRQP0440 GeneCopoeia, China  
rno-miR-34b-5p RmiRQP0980 GeneCopoeia, China  
rno-miR-34c-5p RmiRQP0444 GeneCopoeia, China