Skip to main content

Table 1 Primers used in PCR assay

From: The role of Serpina3n in the reversal effect of ATRA on dexamethasone-inhibited osteogenic differentiation in mesenchymal stem cells

Gene Assay Forward (5′ → 3′) Reverse (5′→ 3′)
GAPDH PCR ACCCAGAAGACTGTGGATGG CACATTGGGGGTAGGAACAC
ALP PCR AGACCAGGTCTGCTCAGGAT ACCCCGCTATTCCAAACAGG
RUNX2 PCR GCCAATCCCTAAGTGTGGCT AACAGAGAGCGAGGGGGTAT
RARα PCR TCTCCCTGGACATTGACCTC GTGTCTTGCTCAGGCGTGTA
RARβ PCR AATGCCACCTCTCATTCAGG GAATGTCTGCAACAGCTGGA
RARγ PCR AGGCAGCAGACTGACCATTT TTCTGGTAGGTGTGCAGCAG
Serpina3n PCR GCTTTTCTGCACTGTGGTGG AGGCTGTAGTCGGTGGAGAT
Serpina3n (primer 1) ChIP AAGGCAAGGGTGATACAGGC TCCCTCATTGACCCCAAAGC
Serpina3n (primer 2) ChIP CCCCCTTTCCACATCGACTC TGTGCTCTGTGCTCAGACTG
Serpina3n (primer 3) ChIP AGCCACTGAGCCTTCACTTC TTCCTTTCTCTCAACCCGCC