Skip to main content

Table 1 Primer sequence

From: Conditioned medium from induced pluripotent stem cell-derived mesenchymal stem cells accelerates cutaneous wound healing through enhanced angiogenesis

Gene Sequence
Mouse ANG-2 forward CTCTGTCTCAGGATGACTCCAG
Mouse ANG-2 reverse AGGTGTTGACATCTTTGCAGAAAG
Mouse EGF forward ACTGGTGTGACACCAAGAGGTC
Mouse EGF reverse CCACAGGTGATCCTCAAACACG
Mouse PIGF forward AGTTTCACAGGAGCGTGGCTTG
Mouse PIGF reverse GATCCAGAGTGGCGAGATAACC
Mouse VEGFA forward CTGCTGTAACGATGAAGCCCTG
Mouse VEGFA reverse GCTGTAGGAAGCTCATCTCTCC
Mouse GAPDH forward CATCACTGCCACCCAGAAGACTG
Mouse GAPDH reverse ATGCCAGTGAGCTTCCCGTTCAG
Human EGF forward TGCGATGCCAAGCAGTCTGTGA
Human EGF reverse GCATAGCCCAATCTGAGAACCAC
Human FGF2 forward AGCGGCTGTACTGCAAAAACGG
Human FGF2 reverse CCTTTGATAGACACAACTCCTCTC
Human HGF forward GAGAGTTGGGTTCTTACTGCACG
Human HGF reverse CTCATCTCCTCTTCCGTGGACA
Human VEGFA forward TTGCCTTGCTGCTCTACCTCCA
Human VEGFA reverse GATGGCAGTAGCTGCGCTGATA
Human GAPDH forward GTCTCCTCTGACTTCAACAGCG
Human GAPDH reverse ACCACCCTGTTGCTGTAGCCAA