Skip to main content

Table 1 Primers for quantitative real-time polymerase chain reaction (qRT-PCR)

From: Adrenomedullin 2 improves bone regeneration in type 1 diabetic rats by restoring imbalanced macrophage polarization and impaired osteogenesis

Gene Forward (5′–3′) Reverse (5′–3′)
ALP CCGCAGGATGTGAACTACT GGTACTGACGGAAGAAGGG
Arg-1 CAGAAGAATGGAAGAGTCAG CAGATATGCAGGGAGTCACC
IL-6 AGCCAGAGTCCTTCAGAGAGAT GCACTAGGTTTGCCGAGTAGAT
iNOS CGAGACGGATAGGCAGAGATTG CTCTTCAAGCACCTCCAGGAA
MRC1 CCTATGAAAATTGGGCTTACGG CTGACAAATCCAGTTGTTGAGG
OCN CAGACAAGTCCCACACAGCA CCAGCAGAGTGAGCAGAGAGA
OPN GGCCGAGGTGATAGCTT CTCTTCATGCGGGAGGT
OSX GGAAAAGGAGGCACAAAGAA CAGGGGAGAGGAGTCCATT
TGF-β CGGAGAGCCCTGGATACCA GCCGCACACAGCAGTTCTT
TNF-α GCTGAGCTCAAACCCTGGTA CGGACTCCGCAAAGTCTAAG
GAPDH (mouse) AAATGGTGAAGGTCGGTGTG AGGTCAATGAAGGGGTCGTT
GAPDH (rat) ATGGCTACAGCAACAGGGT TTATGGGGTCTGGGATGG