Skip to main content

Table 2 Primer sequences used for qPCR

From: Schwann cells promote prevascularization and osteogenesis of tissue-engineered bone via bone marrow mesenchymal stem cell-derived endothelial cells

Gene Primer sequence forward 5′–3′ Primer sequence reverse 5′–3′
Pecam1 TTGGCACCATGAACAAACTAGCA CGCTTCGGAGACTGGTCACA
CD34 TGCCGTCTGTCAATGTTTCTGATTA TCGGATTCCTGAACATTTGATGTC
Kdr AATGCCCATGACCAAGAATGTG GGATAGAGCCGCGTGTCTGAA
Nos 2 CTCACTGTGGCTGTGGTCACCTA GGGTCTTCGGGCTTCAGGTTA
Nos 3 GCGGCTGGTACATGAGTTCAGA AGATCCATGCAGACAGCCACA
TIMP-2 GACACGCTTAGCATCACCCAGA CTGTGACCCAGTCCATCCAGAG
MMP-14 GAGAACTTCGTGTTGCCTGATGAC TTCTGGGCTTATCTGGGACAGAG
GAPDH GGACCAGGTTGTCTCCTGTG CACCTGGAGTACCGGATGT