Skip to main content

Table 2 Sequences of primers

From: Serum exosomes from young rats improve the reduced osteogenic differentiation of BMSCs in aged rats with osteoporosis after fatigue loading in vivo

Gene name Primer sequence
Runx2-F 5′-GACTGTGGTTACCGTCATGGC-3′
Runx2-R 5′-ACTTGGTTTTTCATAACAGCGGA-3′
ALP-F 5′- TGTTGGTCCTGCTGGCAAGAATG-3′
ALP-R 5′-CAGGCACAGTGGTCAAGGTTGG -3′
CollagenI-F 5′- TGTTGGTCCTGCTGGCAAGAATG -3′
CollagenI-R 5′-GTCACCTTGTTCGCCTGTCTCAC -3′
PTEN-F 5′-TTGAAGACCATAACCCACCACAGC -3′
PTEN-R 5′-CATTACACCAGTCCGTCCTTTCCC -3′
GAPDH-F 5′-AGCCCAAGATGCCCTTCAGT-3′
GAPDH-R 5′-CCGTGTTCCTACCCCCAATG-3′
miR-9a-5p 5′-CGCCGTCTTTGGTTATCTAGCTGTATG-3′
miR-19b-3p 5′-CCGTGTGCAAATCCATGCAAAACTGA-3′
miR-20a-5p 5′-CGCCTAAAGTGCTTATAGTGCAGGTAG-3′
miR-335-5p 5′-CGCGCTCAAGAGCAATAACGAAAAATG-3′
miR-433-3p 5′-CGCCGTCTTTGGTTATCTAGCTGTATG-3′
miR-21-5p 5′-CGCCGTAGCTTATCAGACTGATGTTGA-3′
miR-181a 5′-AACATTCAACGCTGTCGGTGAGT-3′
miR-29b 5′-CGCCTAGCACCATTTGAAATCAGTGTT-3′
miR-199a-5p 5′-GCCCAGTGTTCAGACTACCTGTTC-3′
U6-F 5′- GGAACGATACAGAGAAGATTAGC-3′
U6-R 5′-TGGAACGCTTCACGAATTTGCG-3′