Skip to main content

Table 1 Primers used in this study

From: Cell heterogeneity, rather than the cell storage solution, affects the behavior of mesenchymal stem cells in vitro and in vivo

Gene Forward (5′-3′) Reverse (5′-3′)
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
IDO TGCCAACTCTCCAAGAAAC GCAGTCTCCATCACGAAAT
HGF GCTATCGGGGTAAAGACCTACA CGTAGCGTACCTCTGGATTGC
VEGF CTGGGCTGTTCTCGCTT CCCCTCTCCTCTTCCTTCT
TGF-β CTAATGGTGGAAACCCACAACG TATCGCCAGGAATTGTTGCTG
IL-6 CCTGAACCTTCCAAAGATGGC TTCACCAGGCAAGTCTCCTCA
IL-10 GACTTTAAGGGTTACCTGGGTTG TCACATGCGCCTTGATGTCTG