Skip to main content

Table 1 Primers used for SYBR green quantitative real-time PCR

From: Adipose mesenchymal stem cells combined with platelet-rich plasma accelerate diabetic wound healing by modulating the Notch pathway

Gene Sequences (5’->3’) References Accession
Notch1 CCA GCA GAT GAT CTT CCC GTA C
ACT GCC GCT ATT CTT GTC CC
[25] XM_032903023.1
DII-4 TTC CAG GCAACC TTC TCC GA
ACT GCC GCT ATT CTT GTC CC
[26] XM_032903968.1
Jagged-1 CCT CGG GTC AGT TTG AGC TG
CCT TGA GGC ACA CTT TGA AGT A
[27] XM_032904296.1
Hes1 CCA GCC AGT GTC AAC ACG A
AAT GCC GGG AGC TAT CTT TCT
[28] XM_032900059.1
Hey1 GCG CGG ACG AGAATG GAAA
TCA GGT GAT CCA CAG TCA TCT G
[28] NM_010423.2
VEGF GTACCTCCACCATGCCAAGT
TCACATCTGCAAGTACGTTCG
[29] XM_032900655.1
SDF-1 GAG AGC CAC ATC GCC AGA G
TTT CGG GTC AAT GCA CAC TTG
[30] AF189724.1
EPSCm GACCTGCCTTGGTGTCTGTGC
AGCAACCACACCAGCTACAAT
[31] XM_032888182.1
GAPDH AGT TCA ACG GCA CAG TCA A
TAC TCA GCA CCA GCA TCA CC
[32] XM_032902285.1