Skip to main content

Table 1 Real-time PCR primer sequences used in the study

From: EGFL6 regulates angiogenesis and osteogenesis in distraction osteogenesis via Wnt/β-catenin signaling

Gene Forward Reverse
Human EMCN 5′ ACTAAGTGGATGTTGTTGGCT 3′ 5′ AATAGTTCAGTTCAGCAAGGG 3′
Human CD31 5′ GGTGGAGTCTGGAGAGGACATT 3′ 5′ GGGTGGCATTTGAGGTCATT 3′
Human Hif1a 5′ AGAAACCACCTATGACCTGCT 3′ 5′ CGACTGAGGAAAGTCTTGCTA 3′
Human VEGF-A 5′ CAGAAGGAGGAGGGCAGAA 3′ 5′ GTCTCGATTGGATGGCAGTAG 3′
Human GAPDH 5′ ATCCCATCACCATCTTCC 3′ 5′ GAGTCCTTCCACGATACCA 3′
Rat EMCN 5′ AAGCACTGACAGAAACATCCA 3′ 5′ ACTGTTGGTCGTTCCTTTAGG 3′
Rat CD31 5′ CACCGTGATACTGAACAGCAA 3′ 5′ GTCACAATCCCACCTTCTGTC 3′
Rat EGFL6 5′ TAGTACCACTGTGCCTTCTCA 3′ 5′ ACTCGTGTAGGAAGAGCAGAC 3′
Rat OCN 5′ CCTCACACTCCTCGCCCTATT 3′ 5′ CCCTCCTGCTTGGACACAAA 3′
Rat OPN 5′ ATCTCCTAGCCCCACAGACC 3′ 5′ TCCGTGGGAAAATCAGTGACC 3′
Rat ALP 5′ ACCATTCCCACGTCTTCACATTT 3′ 5′ AGACATTCTCTCGTTCACCGCC 3′
Rat BMP2 5′ ACTCGAAATTCCCCGTGACC 3′ 5′ CCACTTCCACCACGAATCCA 3′
Rat RUNX2 5′ ACTTCCTGTGCTCGGTGCT 3′ 5′ GACGGTTATGGTCAAGGTGA 3′
Rat CXCR4 5′ CCTCTGAGGCGTTTGGTGCTC 3′ 5′ TAGATGGTGGGCAGGAAGATC 3′
Rat CXCL2 5′ TCCTCAATGCTGTACTGGTC 3′ 5′ TGAAGTCAACCCTTGGTAGG 3′
Rat Hif1a 5′ GGGTTATGAGCCAGAAGAACT 3′ 5′ CCTGTGGTGACTTGTCCTTTA 3′
Rat VEGF-A 5′ TCAGGAGGACCTTGTGTGATC 3′ 5′ CATTGCTCTGTACCTTGGGAA 3′
Rat COL1 5′ CATCGGTGGTACTAAC 3′ 5′ CTGGATCATATTGCACA 3′
Rat GAPDH 5′ GGCATGGACTGTGGTCATGAG 3′ 5′ TGCACCACCAACTGTTAGC 3′
  1. All primers provided by BioTNT (Shanghai, China)