Skip to main content

Table 1 Primer sequences for RT-PCR

From: hucMSC-derived exosomes attenuate colitis by regulating macrophage pyroptosis via the miR-378a-5p/NLRP3 axis

Species Gene Primer sequence Temperature
Mouse β-actin For:TGGAATCCTGTGGCATCCATGAAAC
Rev:TAAAACGCAGCTCAGTAACAGTCCG
60 °C
NLRP3 For:GAGCTGGACCTCAGTGACAATGC
Rev:ACCAATGCGAGATCCTGACAACAC
60 °C
ASC For:ACAATGACTGTGCTTAGAGACA
Rev:CACAGCTCCAGACTCTTCTTTA
58 °C
Caspase-1 For:AGAGGATTTCTTAACGGATGCA
Rev:TCACAAGACCAGGCATATTCTT
58 °C
IL-1β For:TCGCAGCAGCACATCAACAAGAG
Rev:AGGTCCACGGGAAAGACACAGG
60 °C
IL-18 For:AGACCTGGAATCAGACAACTTT
Rev:TCAGTCATATCCTCGAACACAG
60 °C
IL-6 For:AAGTCCGGAGAGGAGACTTC
Rev:TGGATGGTCTTGGTCCTTAG
58 °C
IL-10 For:TTCTTTCAAACAAAGGACCAGC
Rev:GCAACCCAAGTAACCCTTAAAG
60 °C
TNF-α For:AACTCCAGGCGGTGCCTATG
Rev:TCCAGCTGCTCCTCCACTTG
63 °C
Human β-actin For:CTCAGGAGGAGCAATGATCT
Rev:GACCTGTACGCCAACACAGT
60 °C
NLRP3 For:GCACTTGCTGGACCATCCTC
Rev:GTCCAGTGCACACGATCCAG
60 °C
ASC For:CTCAAGAAGTTCAAGCTGAAGC
Rev:TAGGTCTCCAGGTAGAAGCTG
58 °C
Caspase-1 For:GAAGAAACACTCTGAGCAAGTC
Rev:GATGATGATCACCTTCGGTTTG
58 °C
IL-1β For:GCCAGTGAAATGATGGCTTATT
Rev:AGGAGCACTTCATCTGTTTAGG
60 °C
IL-18 For:GCTGAAGATGATGAAAACCTGG
Rev:CAAATAGAGGCCGATTTCCTTG
60 °C