Skip to main content

Table 2 Primers for RT-PCR

From: Impact of human adipose tissue-derived stem cells on dermatofibrosarcoma protuberans cells in an indirect co-culture: an in vitro study

Gene Forward primer (5'–3') Reverse primer (5’–3’)
GAPDH GGGAAGCTTGTCATCAATGGAA AGAGATGATGACCCTTTTGGCTC
PDGFRB AGCACCTTCGTTCTGACCTG TATTCTCCCGTGTCTAGCCCA
COL1A1 GAGGGCCAAGACGAAGACATC CAGATCACGTCATCGCACAAC
VEGF AGGGCAGAATCATCACGAAGT AGGGTCTCGATTGGATGGCA
HGF GCTATCGGGGTAAAGACCTACA CGTAGCGTACCTCTGGATTGC
bFGF AGAAGAGCGACCCTCACATCA CGGTTAGCACACACTCCTTTG