Skip to main content

Table 3 MSC-EVs and retina common miRNAs; their expression, sequences and effects

From: Therapeutic effects of mesenchymal stem cells-derived extracellular vesicles’ miRNAs on retinal regeneration: a review

miRNA Retina expression patterns Sample miRNA sequence, miRBase accession number Effect Retina ref EV ref
miR-204 RPE, amacrine cells, INL, ONL, GCL (adult), Müller glia, mature retina Human, mouse, medaka fish, zebrafish, rat  > hsa-miR-204-5p MIMAT0000265: UUCCCUUUGUCAUCCUAUGCCU
 > mmu-miR-204-5p MIMAT0000237: UUCCCUUUGUCAUCCUAUGCCU
 > ola-miR-204 MIMAT0022589: UUCCCUUUGUCAUCCUAUGC
 > dre-miR-204-5p MIMAT0001279
UUCCCUUUGUCAUCCUAUGCCU
 > rno-miR-204-5p MIMAT0000877
UUCCCUUUGUCAUCCUAUGCCU
 > hsa-miR-204-3p MIMAT0022693: GCUGGGAAGGCAAAGGGACGU
 > mmu-miR-204-3p MIMAT0017002: GCUGGGAAGGCAAAGGGACGU
 > dre-miR-204-3p MIMAT0031924
GGCUGGGAAGUCAAAGGGACGC
 > rno-miR-204-3p MIMAT0004739
GCUGGGAAGGCAAAGGGACGUU
Differentiation and death of retinal progenitor cells (RPCs). Retinal development. RPE differentiation. Play an important role in the differentiation and function of RPE and retina. Increasing expression from young to adult Müller glia. Expressed in the developing retina during rod photoreceptor differentiation. Inhibition in the medaka fish results gross deficiencies in eye development. Upregulated in light adapted condition. Decreased photoreceptor apoptosis and microglia activation in mouse models of inherited retinal diseases [60, 64,65,66, 90, 93, 95, 96, 100, 102,103,104, 107, 179] [166]
miR-124 Adult retina, cone, rod, RPE, ONL, INL except Müller glia, GCL (adult) ARPE-19, Mouse  > hsa-miR-124-5p MIMAT0004591
CGUGUUCACAGCGGACCUUGAU
 > mmu-miR-124-5p MIMAT0004527
CGUGUUCACAGCGGACCUUGAU
 > hsa-miR-124-3p MIMAT0000422
UAAGGCACGCGGUGAAUGCCAA
 > mmu-miR-124-3p MIMAT0000134
UAAGGCACGCGGUGAAUGCC
Proliferation, differentiation and death of RPCs. Connectivity and plasticity of retinal cells. Controlling the sensitivity of retinal growth cones to the guidance cue Sema3A. Regulating the survival of rod photoreceptors. Stimulating the conversion of cultured murine Müller cells into Müller glia-derived progenitor cells (MGDP). In vitro mouse Müller glia reprogramming into neural progenitors. Survival of cone photoreceptors. Exogenous supplement could be a therapeutic approach for the prevention or treatment of proliferative vitreoretinopathy. Participate in retinal cell maturation and Müller glia reprogramming. MGDP differentiation to retinal neurons. Müller glia to retinal neurons reprogramming. Decrease retinal inflammation and photoreceptor cell death and improve retinal function. Its anti-inflammatory properties have an impact as a therapeutic in treatment of retinal degenerative diseases. Promoting axon growth of RGCs differentiated from RSCs [60, 66, 92,93,94, 108, 114, 143, 179,180,181] [154, 163]
miR-124a All layers except RPE, cone, all differentiated neurons, MGDP Mouse, zebra fish  > hsa-miR-124-5p MIMAT0004591
CGUGUUCACAGCGGACCUUGAU
 > mmu-miR-124-5p MIMAT0004527
CGUGUUCACAGCGGACCUUGAU
 > dre-miR-124-5p MIMAT0031960
CGUGUUCACAGCGGACCUUGAU
 > hsa-miR-124-3p MIMAT0000422
UAAGGCACGCGGUGAAUGCCAA
 > mmu-miR-124-3p MIMAT0000134
UAAGGCACGCGGUGAAUGCC
 > dre-miR-124-3p MIMAT0001819
UAAGGCACGCGGUGAAUGCCAA
Controlling the maturation and survival of retinal cone photoreceptors. Expressed in all neuronal subtypes of the adult retina. Higher levels of expression in photoreceptor cells. Loss of the dominant source of miR-124a triggered death of cone photoreceptors amid retinal development. Essential for the maturation and survival of retinal cones. Knockout of one of the miR-124a genes (miR-124a-1) results in the apoptosis of newly differentiated cone photoreceptors in mice. In MGDPs committed to early neuronal lineages, upregulated during MGDP acquisition of rod phenotypes [65, 90, 93, 99, 104, 110] [156]
miR-181 Retina (GCL, INL), inner plexiform layer Mouse, zebrafish Retinal axon specification and growth [90, 182] [21, 70, 153, 160, 161]
miR-181a Cone, amacrine cells, GCL, INL, adult retina Mouse, zebra fish, medaka fish  > hsa-miR-181a-5p MIMAT0000256
AACAUUCAACGCUGUCGGUGAGU
 > mmu-miR-181a-5p MIMAT0000210
AACAUUCAACGCUGUCGGUGAGU
 > dre-miR-181a-5p MIMAT0001623
AACAUUCAACGCUGUCGGUGAGU
 > ola-miR-181a-5p MIMAT0022586
AACAUUCAACGCUGUCGGU
 > hsa-miR-181a-2-3p MIMAT0004558
ACCACUGACCGUUGACUGUACC
 > mmu-miR-181a-2-3p MIMAT0005443
ACCACCGACCGUUGACUGUACC
 > dre-miR-181a-2-3p MIMAT0032007
ACCAUCGACCGUUGACUGUACC
 > ola-miR-181a-3p MIMAT0022587
ACCAUCGACCGUUGACUGUAC
Control the assembly of visual circuitry by regulating retinal axon specification and growth. Regulate proper neuritogenesis in amacrine cells and RGCs. Expressed in amacrine cells during growth and in adult retinas. Present in both GABAergic and glycinergic amacrine cells [60, 90, 94, 95, 99, 100, 118, 119] [154, 158, 161]
miR-181a-5p Retina, RPE Human, in vitro hESC  > hsa-miR-181a-5p MIMAT0000256
AACAUUCAACGCUGUCGGUGAGU
 > mmu-miR-181a-5p MIMAT0000210
AACAUUCAACGCUGUCGGUGAGU
 > dre-miR-181a-5p MIMAT0001623
AACAUUCAACGCUGUCGGUGAGU
 > ola-miR-181a-5p MIMAT0022586
AACAUUCAACGCUGUCGGU
hESC differentiation into RPE cells [124, 136] [83]
miR-181b Cone, amacrine cells, GCL, ciliary margin zone (CMZ), INL, mature retina Mouse, zebra fish, medaka fish,  > hsa-miR-181b-5p MIMAT0000257
AACAUUCAUUGCUGUCGGUGGGU
 > mmu-miR-181b-5p MIMAT0000673
AACAUUCAUUGCUGUCGGUGGGUU
 > dre-miR-181b-5p MIMAT0001270
AACAUUCAUUGCUGUCGGUGGG
 > ola-miR-181b-5p MIMAT0022540
AACAUUCAUUGCUGUCGGUGGGUU
 > hsa-miR-181b-3p MIMAT0022692
CUCACUGAACAAUGAAUGCAA
 > mmu-miR-181b-1-3p MIMAT0017067
CUCACUGAACAAUGAAUGCAA
 > dre-miR-181b-3-3p MIMAT0048656
CUCACUGAACAAUGAAUGCAA
 > ola-miR-181b-3p MIMAT0022541
CUCACUGAACGAUGAAUGCA
Control the assembly of visual circuitry by regulating retinal axon specification and growth. Takes part in the specification of later RPCs and mature retinal neurons. Regulate proper neuritogenesis in amacrine cells and RGCs [60, 94, 95, 99, 101, 107, 118] [161]
miR-181c RPE, amacrine cells, GCL, INL, MGDP Human, mouse, zebra fish  > hsa-miR-181c-5p MIMAT0000258
AACAUUCAACCUGUCGGUGAGU
 > mmu-miR-181c-5p MIMAT0000674
AACAUUCAACCUGUCGGUGAGU
 > dre-miR-181c-5p MIMAT0001852
CACAUUCAUUGCUGUCGGUGGG
 > hsa-miR-181c-3p MIMAT0004559
AACCAUCGACCGUUGAGUGGAC
 > mmu-miR-181c-3p MIMAT0017068
ACCAUCGACCGUUGAGUGGACC
 > dre-miR-181c-3p MIMAT0031980
CUCGCCGGACAAUGAAUGAGAA
Promoting RPE differentiation. Upregulated during MGDP acquisition of rod phenotypes [95, 101, 111, 129] [158, 159, 161, 168]
miR-181d RPE, GCL, INL Human, mouse  > hsa-miR-181d-5p MIMAT0002821
AACAUUCAUUGUUGUCGGUGGGU
 > mmu-miR-181d-5p MIMAT0004324
AACAUUCAUUGUUGUCGGUGGGU
 > hsa-miR-181d-3p MIMAT0026608
CCACCGGGGGAUGAAUGUCAC
 > mmu-miR-181d-3p MIMAT0017264
CCCACCGGGGGAUGAAUGUCA
Upregulated miRNA in RPE during ESC differentiation [101, 125] [161]
miR-9 Müller Glia, strongly expressed in neonatal retina, CMZ maturing cells and mature amacrine cells, RPE, INL, MGDP, developing retina ARPE-19, mouse, zebrafish  > hsa-miR-9-5p MIMAT0000441
UCUUUGGUUAUCUAGCUGUAUGA
 > mmu-miR-9-5p MIMAT0000142
UCUUUGGUUAUCUAGCUGUAUGA
 > dre-miR-9-5p MIMAT0001769
UCUUUGGUUAUCUAGCUGUAUGA
 > hsa-miR-9-3p MIMAT0000442
AUAAAGCUAGAUAACCGAAAGU
 > mmu-miR-9-3p MIMAT0000143
AUAAAGCUAGAUAACCGAAAGU
 > dre-miR-9-3p MIMAT0003156
UAAAGCUAGAUAACCGAAAGU
Stimulating the conversion of cultured murine Müller cells into MGDP cells. Play a significant role in orchestrating progenitor competence. Participates in the specification of later progenitor cells and mature retinal neurons. Regulate RPE cell growth, differentiation or development. Increasing expression from young to adult Müller glia. Müller glia to retinal neurons reprogramming. Rescue the effects of Dicer1 deletion on the Müller glia phenotype. Highly expressed in neonatal retina. Upregulated during MGDP acquisition of rod phenotypes (9*). Overexpression leads to decreased RPC proliferation and increased neuronal and glial differentiation. Regulate the transition between early RPCs and late RPCs. Promoted the differentiation of neuronal cells from RSCs [66, 90, 94, 95, 99, 101, 103, 107, 108, 111, 116, 123, 183,184,185,186] [187]
miR-182 Rod/cone/bipolar, INL (Not as vigorous as miR-183), GCL, ONL, mature retina Mouse, Zebrafish  > hsa-miR-182-5p MIMAT0000259
UUUGGCAAUGGUAGAACUCACACU
 > mmu-miR-182-5p MIMAT0000211
UUUGGCAAUGGUAGAACUCACACCG
 > dre-miR-182-5p MIMAT0001271
UUUGGCAAUGGUAGAACUCACA
 > hsa-miR-182-3p MIMAT0000260
UGGUUCUAGACUUGCCAACUA
 > dre-miR-182-3p MIMAT0001272
UGGUUCUAGACUUGCCAACUA
 > mmu-miR-182-3p MIMAT0016995
GUGGUUCUAGACUUGCCAACU
May play crucial roles in the photoreceptors and bipolar cells. Maintain adult cone photoreceptor outer segments and visual function. Maintaining retinal function. Preservation of retinal nerve fiber layer thickness and preservation of RGC function. Tetramethylpyrazine protects primary RGCs against H2O2‑induced damage by suppressing apoptosis and oxidative stress via the miR‑182/mitochondrial apoptotic pathway [90, 99, 101, 107, 120, 188, 189] [190]
miR-183 Rod/cone/bipolar, INL (May have peripheral-to-central gradient), GCL, ONL, mature retina Mouse, zebrafish  > hsa-miR-183-5p MIMAT0000261
UAUGGCACUGGUAGAAUUCACU
 > mmu-miR-183-5p MIMAT0000212
UAUGGCACUGGUAGAAUUCACU
 > dre-miR-183-5p MIMAT0001273
UAUGGCACUGGUAGAAUUCACUG
 > hsa-miR-183-3p MIMAT0004560
GUGAAUUACCGAAGGGCCAUAA
 > mmu-miR-183-3p MIMAT0004539
GUGAAUUACCGAAGGGCCAUAA
 > dre-miR-183-3p MIMAT0031921
UGAAUUACCAAAGGGCCAUAA
May play important roles in the photoreceptors and bipolar cells. Maintain adult cone photoreceptor outer segments and visual function [99, 101, 107, 120] [70]
miR-96 Rod/cone/bipolar, INL (Not as robust as miR-183), ONL, mature retina Mouse, zebrafish  > hsa-miR-96-5p MIMAT0000095
UUUGGCACUAGCACAUUUUUGCU
 > mmu-miR-96-5p MIMAT0000541
UUUGGCACUAGCACAUUUUUGCU
 > dre-miR-96-5p MIMAT0001811
UUUGGCACUAGCACAUUUUUGCU
 > hsa-miR-96-3p MIMAT0004510
AAUCAUGUGCAGUGCCAAUAUG
 > mmu-miR-96-3p MIMAT0017021
CAAUCAUGUGUAGUGCCAAUAU
 > dre-miR-96-3p MIMAT0031956
CAAUUAUGUGUAGUGCCAAUAU
May play crucial roles in the photoreceptors and bipolar cells [99, 101, 107] [191]
miR-125b CMZ, INL, GCL, developing retina ARPE-19, in vitro hESC, mouse, zebrafish, Rat,  > hsa-miR-125b-5p MIMAT0000423
UCCCUGAGACCCUAACUUGUGA
 > mmu-miR-125b-5p MIMAT0000136
UCCCUGAGACCCUAACUUGUGA
 > rno-miR-125b-5p MIMAT0000830
UCCCUGAGACCCUAACUUGUGA
 > dre-miR-125b-5p MIMAT0001821
UCCCUGAGACCCUAACUUGUGA
 > hsa-miR-125b-2-3p MIMAT0004603
UCACAAGUCAGGCUCUUGGGAC
 > mmu-miR-125b-2-3p MIMAT0004529
ACAAGUCAGGUUCUUGGGACCU
 > rno-miR-125b-2-3p MIMAT0026467
ACAAGUCAGGCUCUUGGGACCU
 > dre-miR-125b-2-3p MIMAT0031964
CGGGUUGGGUUCUCGGGAGCU
 > hsa-miR-125b-1-3p MIMAT0004592
ACGGGUUAGGCUCUUGGGAGCU
 > mmu-miR-125b-1-3p MIMAT0004669
ACGGGUUAGGCUCUUGGGAGCU
 > rno-miR-125b-1-3p MIMAT0004730
ACGGGUUAGGCUCUUGGGAGCU
 > dre-miR-125b-1-3p MIMAT0031963
ACGGGUUAGGUUCUUGGGAGCU
Play a significant role in orchestrating progenitor competence. Regulate cell growth, differentiation or development. Important functions during human RPE cell differentiation [90, 99, 107, 124, 125, 183] [40, 154, 156, 159, 164, 165, 174]
miR-125b-5p Retina, Müller glia Human, in vitro hESC  > hsa-miR-125b-5p MIMAT0000423
UCCCUGAGACCCUAACUUGUGA
 > mmu-miR-125b-5p MIMAT0000136
UCCCUGAGACCCUAACUUGUGA
Increasing expression from young to adult Müller glia. hESC differentiation into RPE cells [66, 124, 136] [21, 61, 82, 83, 88, 159, 172, 173, 175]
miR-26 Rod Mouse  > hsa-miR-26a-5p MIMAT0000082
UUCAAGUAAUCCAGGAUAGGCU
 > mmu-miR-26a-5p MIMAT0000533
UUCAAGUAAUCCAGGAUAGGCU
 > hsa-miR-26a-1-3p MIMAT0004499
CCUAUUCUUGGUUACUUGCACG
 > mmu-miR-26a-1-3p MIMAT0017020
CCUAUUCUUGGUUACUUGCACG
 > hsa-miR-26b-5p MIMAT0000083
UUCAAGUAAUUCAGGAUAGGU
 > mmu-miR-26b-5p MIMAT0000534
UUCAAGUAAUUCAGGAUAGGU
 > hsa-miR-26b-3p MIMAT0004500
CCUGUUCUCCAUUACUUGGCU
 > mmu-miR-26b-3p MIMAT0004630
CCUGUUCUCCAUUACUUGGCUC
Regulating the survival of rod photoreceptors [94, 192] [193]
miR-26a RPE, Cone, Retina Human, mouse  > hsa-miR-26a-5p MIMAT0000082
UUCAAGUAAUCCAGGAUAGGCU
 > mmu-miR-26a-5p MIMAT0000533
UUCAAGUAAUCCAGGAUAGGCU
 > hsa-miR-26a-2-3p MIMAT0004681
CCUAUUCUUGAUUACUUGUUUC
 > mmu-miR-26a-2-3p MIMAT0017058
CCUGUUCUUGAUUACUUGUUUC
 > hsa-miR-26a-1-3p MIMAT0004499
CCUAUUCUUGGUUACUUGCACG
 > mmu-miR-26a-1-3p MIMAT0017020
CCUAUUCUUGGUUACUUGCACG
Upregulated miRNA in RPE during ESC differentiation [90, 107, 120, 125] [154]
miR-26a-5p Retina, RPE Human, in vitro hESC  > hsa-miR-26a-5p MIMAT0000082
UUCAAGUAAUCCAGGAUAGGCU
 > mmu-miR-26a-5p MIMAT0000533
UUCAAGUAAUCCAGGAUAGGCU
hESC differentiation into RPE cells [124, 136] [82, 156]
miR-30 Rod Mouse  > hsa-miR-30a-5p MIMAT0000087
UGUAAACAUCCUCGACUGGAAG
 > mmu-miR-30a-5p MIMAT0000128
UGUAAACAUCCUCGACUGGAAG
 > hsa-miR-30a-3p MIMAT0000088
CUUUCAGUCGGAUGUUUGCAGC
 > mmu-miR-30a-3p MIMAT0000129
CUUUCAGUCGGAUGUUUGCAGC
 > hsa-miR-30e-5p MIMAT0000692
UGUAAACAUCCUUGACUGGAAG
 > mmu-miR-30e-5p MIMAT0000248
UGUAAACAUCCUUGACUGGAAG
 > hsa-miR-30e-3p MIMAT0000693
CUUUCAGUCGGAUGUUUACAGC
 > mmu-miR-30e-3p MIMAT0000249
CUUUCAGUCGGAUGUUUACAGC
 > hsa-miR-30c-5p MIMAT0000244
UGUAAACAUCCUACACUCUCAGC
 > mmu-miR-30c-5p MIMAT0000514
UGUAAACAUCCUACACUCUCAGC
 > mmu-miR-30c-5p MIMAT0000514
UGUAAACAUCCUACACUCUCAGC
 > hsa-miR-30c-2-3p MIMAT0004550
CUGGGAGAAGGCUGUUUACUCU
 > mmu-miR-30c-2-3p MIMAT0005438
CUGGGAGAAGGCUGUUUACUCU
 > mmu-miR-30c-1-3p MIMAT0004616
CUGGGAGAGGGUUGUUUACUCC
 > hsa-miR-30d-5p MIMAT0000245
UGUAAACAUCCCCGACUGGAAG
 > mmu-miR-30d-5p MIMAT0000515
UGUAAACAUCCCCGACUGGAAG
 > hsa-miR-30d-3p MIMAT0004551
CUUUCAGUCAGAUGUUUGCUGC
 > mmu-miR-30d-3p MIMAT0017011
CUUUCAGUCAGAUGUUUGCUGC
 > hsa-miR-30b-5p MIMAT0000420
UGUAAACAUCCUACACUCAGCU
 > mmu-miR-30b-5p MIMAT0000130
UGUAAACAUCCUACACUCAGCU
 > hsa-miR-30b-3p MIMAT0004589
CUGGGAGGUGGAUGUUUACUUC
 > mmu-miR-30b-3p MIMAT0004524
CUGGGAUGUGGAUGUUUACGUC
 > mmu-miR-30f MIMAT0025179
GUAAACAUCCGACUGAAAGCUC
Regulating the survival of rod photoreceptors. Preservation of retinal nerve fiber layer thickness and preservation of RGC function [94, 189, 192] [21, 61, 70]
miR-30a GCL, INL Mouse  > hsa-miR-30a-5p MIMAT0000087
UGUAAACAUCCUCGACUGGAAG
 > mmu-miR-30a-5p MIMAT0000128
UGUAAACAUCCUCGACUGGAAG
 > hsa-miR-30a-3p MIMAT0000088
CUUUCAGUCGGAUGUUUGCAGC
 > mmu-miR-30a-3p MIMAT0000129
CUUUCAGUCGGAUGUUUGCAGC
ND [101, 107] [158]
miR-30b RGC, GCL, INL, RPE In vitro hESC, mouse, rat  > hsa-miR-30b-5p MIMAT0000420
UGUAAACAUCCUACACUCAGCU
 > mmu-miR-30b-5p MIMAT0000130
UGUAAACAUCCUACACUCAGCU
 > rno-miR-30b-5p MIMAT0000806
UGUAAACAUCCUACACUCAGCU
 > hsa-miR-30b-3p MIMAT0004589
CUGGGAGGUGGAUGUUUACUUC
 > mmu-miR-30b-3p MIMAT0004524
CUGGGAUGUGGAUGUUUACGUC
 > rno-miR-30b-3p MIMAT0004721
CUGGGAUGUGGAUGUUUACGUC
Upregulated in dark adaptation. Promotes axon outgrowth of RGCs. hESC differentiation into RPE cells [90, 124, 194] [156, 168]
miR-126 Retina Mouse  > hsa-miR-126-5p MIMAT0000444
CAUUAUUACUUUUGGUACGCG
 > mmu-miR-126a-5p MIMAT0000137
CAUUAUUACUUUUGGUACGCG
 > hsa-miR-126-3p MIMAT0000445
UCGUACCGUGAGUAAUAAUGCG
 > mmu-miR-126a-3p MIMAT0000138
UCGUACCGUGAGUAAUAAUGCG
Upregulated in dark adaptation. Vascularization of the retina was severely impaired in mice that survived the miR-126 deletion. Required for the development of different retinal vascular layers. miR-126-5p is expressed in endothelial cells but also by retinal ganglion cells (RGCs) of the mouse postnatal retina and takes part in protecting endothelial cells from apoptosis during the development of the retinal vasculature. Survival of Müller cells in a mouse model using vimentin fluorescence staining. A potential therapeutic agent to keep the stability of the Blood Retina Barrier (BRB) in ischemic retinopathy. Reduces hyperglycemia-induced retinal inflammation by downregulating the HMGB1 signaling pathway [90, 128, 195,196,197] [61, 89, 152, 156, 160, 167, 168]
miR-126-3p RPE Human, mouse  > hsa-miR-126-3p MIMAT0000445
UCGUACCGUGAGUAAUAAUGCG
 > mmu-miR-126a-3p MIMAT0000138
UCGUACCGUGAGUAAUAAUGCG
 > mmu-miR-126b-3p MIMAT0029895
CGCGUACCAAAAGUAAUAAUGUG
Repress vascular endothelial growth factor (VEGF-A) expression in RPE cells [101, 136, 195] [61, 168]
miR-107 Retina Mouse  > hsa-miR-107 MIMAT0000104
AGCAGCAUUGUACAGGGCUAUCA
 > mmu-miR-107-3p MIMAT0000647
AGCAGCAUUGUACAGGGCUAUCA
Upregulated in dark adaptation [90] [154]
miR-103 Developing retina Mouse  > hsa-miR-103a-2-5p MIMAT0009196
AGCUUCUUUACAGUGCUGCCUUG
 > mmu-miR-103–2-5p MIMAT0017025
AGCUUCUUUACAGUGCUGCCUUG
 > hsa-miR-103a-3p MIMAT0000101
AGCAGCAUUGUACAGGGCUAUGA
 > mmu-miR-103-3p MIMAT0000546
AGCAGCAUUGUACAGGGCUAUGA
 > hsa-miR-103a-1-5p MIMAT0037306
GGCUUCUUUACAGUGCUGCCUUG
 > mmu-miR-103–1-5p MIMAT0017024
GGCUUCUUUACAGUGCUGCCUUG
Upregulated in dark adaptation. Regulates mitotic proliferation [90, 107] [154]
miR-31 MGDP cells, RPE Mouse, zebra fish  > hsa-miR-31-5p MIMAT0000089
AGGCAAGAUGCUGGCAUAGCU
 > mmu-miR-31-5p MIMAT0000538
AGGCAAGAUGCUGGCAUAGCUG
 > hsa-miR-31-3p MIMAT0004504
UGCUAUGCCAACAUAUUGCCAU
 > mmu-miR-31-3p MIMAT0004634
UGCUAUGCCAACAUAUUGCCAUC
 > dre-miR-31 MIMAT0003347
UGGCAAGAUGUUGGCAUAGCUG
Proliferation of MGDP cells. Knockdown reduces INL proliferation at 72 h of constant light. MGDP’s proliferation [66, 90, 101, 108, 109] [154, 174]
Let-7 INL / GCL, rod Mouse Differentiation and death of RPCs. Regulating the survival of rod photoreceptors. Play a significant role in orchestrating progenitor competence. Participates in retinal cell maturation and Müller glia reprogramming. Influence the neuronal versus glial decision and the final differentiation of Müller glia. Critically involved in Wnt/Lin28-regulated Müller glia proliferation. May link cell proliferation to developmental time and regulate the ongoing cell cycle elongation that takes place during development. Expression maintains the differentiated state of Müller glia cells. Regulate the transition between early RPCs and late RPCs [66, 90, 93, 94, 183, 185, 198,199,200] [152]
Let-7a RPE, retina, developing retina Human, ARPE-19, in vitro hESC, mouse  > hsa-let-7a-5p MIMAT0000062
UGAGGUAGUAGGUUGUAUAGUU
 > mmu-let-7a-5p MIMAT0000521
UGAGGUAGUAGGUUGUAUAGUU
 > hsa-let-7a-3p MIMAT0004481
CUAUACAAUCUACUGUCUUUC
 > mmu-let-7a-1-3p MIMAT0004620
CUAUACAAUCUACUGUCUUUCC
 > hsa-let-7a-2-3p MIMAT0010195
CUGUACAGCCUCCUAGCUUUCC
 > mmu-let-7a-2-3p MIMAT0017015
CUGUACAGCCUCCUAGCUUUC
Upregulated miRNA in RPE during ESC Differentiation. Regulate RPE cell growth, differentiation or development. Müller glia dedifferentiation. Important functions during human RPE cell differentiation [66, 107, 123,124,125] [154, 156, 165]
Let-7a-5p Retina Human, in vitro hESC  > hsa-let-7a-5p MIMAT0000062
UGAGGUAGUAGGUUGUAUAGUU
 > mmu-let-7a-5p MIMAT0000521
UGAGGUAGUAGGUUGUAUAGUU
hESC differentiation into RPE cells [124, 136] [3, 82, 83, 172, 173, 175]
Let-7b Retina, CMZ, INL, RPE, developing retina ARPE-19, mouse, zebrafish  > hsa-let-7b-5p MIMAT0000063
UGAGGUAGUAGGUUGUGUGGUU
 > mmu-let-7b-5p MIMAT0000522
UGAGGUAGUAGGUUGUGUGGUU
 > dre-let-7b MIMAT0001760
UGAGGUAGUAGGUUGUGUGGUU
 > hsa-let-7b-3p MIMAT0004482
CUAUACAACCUACUGCCUUCCC
 > mmu-let-7b-3p MIMAT0004621
CUAUACAACCUACUGCCUUCCC
Participates in the functions of RSCs or early RPCs. Regulate RPE cell growth, differentiation or development. RPC differentiation enhancement [90, 99, 100, 107, 123, 201] [21, 154, 156, 158, 160, 161, 167, 168]
Let-7b-5p RPE Human  > hsa-let-7b-5p MIMAT0000063
UGAGGUAGUAGGUUGUGUGGUU
 > mmu-let-7b-5p MIMAT0000522
UGAGGUAGUAGGUUGUGUGGUU
ND [136] [83]
Let-7c RPE, retina Human, mouse  > hsa-let-7c-5p MIMAT0000064
UGAGGUAGUAGGUUGUAUGGUU
 > mmu-let-7c-5p MIMAT0000523
UGAGGUAGUAGGUUGUAUGGUU
 > hsa-let-7c-3p MIMAT0026472
CUGUACAACCUUCUAGCUUUCC
 > mmu-let-7c-1-3p MIMAT0004622
CUGUACAACCUUCUAGCUUUCC
Upregulated in RPE during ESC differentiation [107, 125] [21, 70, 154, 156, 160, 167]
Let-7c-5p Retina Human  > hsa-let-7c-5p MIMAT0000064
UGAGGUAGUAGGUUGUAUGGUU
 > mmu-let-7c-5p MIMAT0000523
UGAGGUAGUAGGUUGUAUGGUU
ND [136] [83]
Let-7d INL (amacrine, bipolar), RPE, retina ARPE-19, mouse  > hsa-let-7d-5p MIMAT0000065
AGAGGUAGUAGGUUGCAUAGUU
 > mmu-let-7d-5p MIMAT0000383
AGAGGUAGUAGGUUGCAUAGUU
 > hsa-let-7d-3p MIMAT0004484
CUAUACGACCUGCUGCCUUUCU
 > mmu-let-7d-3p MIMAT0000384
CUAUACGACCUGCUGCCUUUCU
Regulate RPE cell growth, differentiation or development. Plays crucial roles in neural fate specification with foreseeable function in RPC differentiation [99, 103, 107, 123] [154]
Let-7e GCL, INL, photoreceptors, retina Mouse  > hsa-let-7e-5p MIMAT0000066
UGAGGUAGGAGGUUGUAUAGUU
 > mmu-let-7e-5p MIMAT0000524
UGAGGUAGGAGGUUGUAUAGUU
 > hsa-let-7e-3p MIMAT0004485
CUAUACGGCCUCCUAGCUUUCC
 > mmu-let-7e-3p MIMAT0017016
CUAUACGGCCUCCUAGCUUUCC
Regulate RPE cell growth, differentiation or development. hESC differentiation into RPE cells [101, 107, 123] [83, 154, 156]
Let-7f RPE, cone, developing retina Human, Mouse  > hsa-let-7f-5p MIMAT0000067
UGAGGUAGUAGAUUGUAUAGUU
 > mmu-let-7f-5p MIMAT0000525
UGAGGUAGUAGAUUGUAUAGUU
 > hsa-let-7f-1-3p MIMAT0004486
CUAUACAAUCUAUUGCCUUCCC
 > mmu-let-7f-1-3p MIMAT0004623
CUAUACAAUCUAUUGCCUUCCC
 > hsa-let-7f-2-3p MIMAT0004487
CUAUACAGUCUACUGUCUUUCC
 > mmu-let-7f-2-3p MIMAT0017017
CUAUACAGUCUACUGUCUUUC
Upregulated in dark adaptation. Upregulated miRNA in RPE during ESC Differentiation [90, 94, 107, 125] [154, 156, 165]
Let-7f-5p Retina, RPE Human, in vitro hESC  > hsa-let-7f-5p MIMAT0000067
UGAGGUAGUAGAUUGUAUAGUU
 > mmu-let-7f-5p MIMAT0000525
UGAGGUAGUAGAUUGUAUAGUU
hESC differentiation into RPE cells [124, 136] [82, 88, 175]
Let-7i RPE, retina Human, mouse  > hsa-let-7i-5p MIMAT0000415
UGAGGUAGUAGUUUGUGCUGUU
 > mmu-let-7i-5p MIMAT0000122
UGAGGUAGUAGUUUGUGCUGUU
 > hsa-let-7i-3p MIMAT0004585
CUGCGCAAGCUACUGCCUUGCU
 > mmu-let-7i-3p MIMAT0004520
CUGCGCAAGCUACUGCCUUGCU
Upregulated in dark adaptation. Upregulated miRNA in RPE during ESC differentiation [90, 107, 125] [82, 83, 154]
miR-23a RPE, GCL, Müller glia, retina Human, ARPE-19, in vitro Müller glia, mouse  > hsa-miR-23a-5p MIMAT0004496
GGGGUUCCUGGGGAUGGGAUUU
 > mmu-miR-23a-5p MIMAT0017019
GGGGUUCCUGGGGAUGGGAUUU
 > hsa-miR-23a-3p MIMAT0000078
AUCACAUUGCCAGGGAUUUCC
 > mmu-miR-23a-3p MIMAT0000532
AUCACAUUGCCAGGGAUUUCC
Upregulated miRNA in RPE during ESC differentiation. Downregulated in the RPE derived from patients with AMD, manipulation of this miRNA modulated the susceptibility to apoptosis of RPE-derived cell lines. Increasing expression from young to adult Müller glia. Increased expression in in vitro Müller glia. Müller glia dedifferentiation. miR‐374 can work with miR‐23a to cooperatively regulate the expression of Brn3b, thereby influencing RGC development [65, 66, 90, 101, 107, 123, 125, 202] [154, 156, 159, 165]
miR-23a-3p RPE, retina Human, in vitro hESC  > hsa-miR-23a-3p MIMAT0000078
AUCACAUUGCCAGGGAUUUCC
 > mmu-miR-23a-3p MIMAT0000532
AUCACAUUGCCAGGGAUUUCC
hESC differentiation into RPE cells [124, 136] [83, 88, 173, 175, 203]
miR-106 Retina Mouse  > hsa-miR-106a-5p MIMAT0000103
AAAAGUGCUUACAGUGCAGGUAG
 > mmu-miR-106a-5p MIMAT0000385
CAAAGUGCUAACAGUGCAGGUAG
 > hsa-miR-106a-3p MIMAT0004517
CUGCAAUGUAAGCACUUCUUAC
 > mmu-miR-106a-3p MIMAT0017009
ACUGCAGUGCCAGCACUUCUUAC
 > hsa-miR-106b-5p MIMAT0000680
UAAAGUGCUGACAGUGCAGAU
 > mmu-miR-106b-5p MIMAT0000386
UAAAGUGCUGACAGUGCAGAU
 > hsa-miR-106b-3p MIMAT0004672
CCGCACUGUGGGUACUUGCUGC
 > mmu-miR-106b-3p MIMAT0004582
CCGCACUGUGGGUACUUGCUGC
Key regulators of the neurogenic-to-gliogenic transition in neural progenitor cells [66, 90] [203]
miR-106a GCL, INL, RPE, developing retina Mouse  > hsa-miR-106a-5p MIMAT0000103
AAAAGUGCUUACAGUGCAGGUAG
 > mmu-miR-106a-5p MIMAT0000385
CAAAGUGCUAACAGUGCAGGUAG
 > hsa-miR-106a-3p MIMAT0004517
CUGCAAUGUAAGCACUUCUUAC
 > mmu-miR-106a-3p MIMAT0017009
ACUGCAGUGCCAGCACUUCUUAC
Regulates mitotic proliferation [101, 107] [172]
miR-143 Retina, Müller glia In vitro Müller glia, mouse  > hsa-miR-143-5p MIMAT0004599
GGUGCAGUGCUGCAUCUCUGGU
 > mmu-miR-143-5p MIMAT0017006
GGUGCAGUGCUGCAUCUCUGG
 > hsa-miR-143-3p MIMAT0000435
UGAGAUGAAGCACUGUAGCUC
 > mmu-miR-143-3p MIMAT0000247
UGAGAUGAAGCACUGUAGCUC
Increased expression in in vitro Müller glia. Alleviates retinal neovascularization [66, 90, 107, 204] [42, 153, 154, 163]
miR-142-5p Retina, RPE Human  > hsa-miR-142-5p MIMAT0000433
CAUAAAGUAGAAAGCACUACU
 > mmu-miR-142a-5p MIMAT0000154
CAUAAAGUAGAAAGCACUACU
ND [136] [174]
miR-143-3p Retina Human  > hsa-miR-143-3p MIMAT0000435
UGAGAUGAAGCACUGUAGCUC
 > mmu-miR-143-3p MIMAT0000247
UGAGAUGAAGCACUGUAGCUC
ND [136] [82,83,84, 88]
miR-200b Retina, developing retina, ganglion cell, Müller glia cell, human Müller cell line Mouse, rat  > hsa-miR-200b-5p MIMAT0004571
CAUCUUACUGGGCAGCAUUGGA
 > mmu-miR-200b-5p MIMAT0004545
CAUCUUACUGGGCAGCAUUGGA
 > rno-miR-200b-5p MIMAT0017152
CAUCUUACUGGGCAGCAUUGGA
 > hsa-miR-200b-3p MIMAT0000318
UAAUACUGCCUGGUAAUGAUGA
 > mmu-miR-200b-3p MIMAT0000233
UAAUACUGCCUGGUAAUGAUGA
 > rno-miR-200b-3p MIMAT0000875
UAAUACUGCCUGGUAAUGAUGAC
The regulation of miR-200b in retinal neovascular diseases may prohibit the deviating expression of critical factors associated with pathological angiogenesis. Therapeutic effect on DR [90, 107, 128, 134, 205] [156]
miR-206 Retina Human, rat  > hsa-miR-206 MIMAT0000462
UGGAAUGUAAGGAAGUGUGUGG
 > rno-miR-206-3p MIMAT0000879
UGGAAUGUAAGGAAGUGUGUGG
ND [90] [61, 166]
miR-146a Müller glia Human, zebra fish, rat  > hsa-miR-146a-5p MIMAT0000449
UGAGAACUGAAUUCCAUGGGUU
 > rno-miR-146a-5p MIMAT0000852
UGAGAACUGAAUUCCAUGGGUU
 > dre-miR-146a MIMAT0001843
UGAGAACUGAAUUCCAUAGAUGG
 > hsa-miR-146a-3p MIMAT0004608
CCUCUGAAAUUCAGUUCUUCAG
 > rno-miR-146a-3p MIMAT0017132
ACCUGUGAAGUUCAGUUCUUU
Proliferation of MGDP cells. Play roles in Müller glia dedifferentiation and proliferation, along with neuronal progenitor cell proliferation and migration. Its reduction reduces INL proliferation at 51 h of light treatment. The rhythmicity of miR-146a expression in the diabetic retina may proceed to mediate rhythmicity of the inflammatory response in retinal cells and provide a new approach to regulation of inflammation in DR. A potential therapeutic target for reducing inflammation in retinal microvascular endothelial cells through inhibition of TLR4/NF-κB and TNFα. Differentiation process of human parthenogenetic embryonic stem cell (hPESC)-derived RPE cells [91, 108, 109, 131, 206] [21, 61, 152,153,154,155,156, 158,159,160,161]
miR-146a-5p RPE Human  > hsa-miR-146a-5p MIMAT0000449
UGAGAACUGAAUUCCAUGGGUU
 > mmu-miR-146a-5p MIMAT0000158
UGAGAACUGAAUUCCAUGGGUU
ND [136] [82]
miR-886 RPE Human  > hsa-mir-886 MI0005527
CACUCCUACCCGGGUCGGAGUUAGCUCAAGCGGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUUAUGCAAUAA
Differentiation process of hPESC-derived RPE cells [91] [152]
miR-10a RPE Human  > hsa-miR-10a-5p MIMAT0000253
UACCCUGUAGAUCCGAAUUUGUG
 > mmu-miR-10a-5p MIMAT0000648
UACCCUGUAGAUCCGAAUUUGUG
 > hsa-miR-10a-3p MIMAT0004555
CAAAUUCGUAUCUAGGGGAAUA
 > mmu-miR-10a-3p MIMAT0004659
CAAAUUCGUAUCUAGGGGAAUA
Differentiation process of hPESC-derived RPE cells [91] [193]
miR-10a-5p RPE Human  > hsa-miR-10a-5p MIMAT0000253
UACCCUGUAGAUCCGAAUUUGUG
 > mmu-miR-10a-5p MIMAT0000648
UACCCUGUAGAUCCGAAUUUGUG
ND [136] [82]
miR-34a RPE, retina ARPE-19, in vitro hESC, mouse  > hsa-miR-34a-5p MIMAT0000255
UGGCAGUGUCUUAGCUGGUUGU
 > mmu-miR-34a-5p MIMAT0000542
UGGCAGUGUCUUAGCUGGUUGU
 > hsa-miR-34a-3p MIMAT0004557
CAAUCAGCAAGUAUACUGCCCU
 > mmu-miR-34a-3p MIMAT0017022
AAUCAGCAAGUAUACUGCCCU
Inhibit the proliferation and migration of RPE cells. Modulated the proliferation and migration of cultured RPE cell lines. hESC differentiation into RPE cells [65, 107, 124, 135] [83, 156]
miR-22 Rod, RPE, Müller glia, retina Human, in vitro Müller glia, mouse  > hsa-miR-22-5p MIMAT0004495
AGUUCUUCAGUGGCAAGCUUUA
 > mmu-miR-22-5p MIMAT0004629
AGUUCUUCAGUGGCAAGCUUUA
 > hsa-miR-22-3p MIMAT0000077
AAGCUGCCAGUUGAAGAACUGU
 > mmu-miR-22-3p MIMAT0000531
AAGCUGCCAGUUGAAGAACUGU
Regulating the survival of rod photoreceptors. Upregulated miRNA in RPE during ESC differentiation. Increased expression in in vitro Müller glia [66, 94, 107, 125, 192] [21, 40, 42, 61, 70, 154, 156, 164, 169, 170]
miR-22-3p Retina Human  > hsa-miR-22-3p MIMAT0000077
AAGCUGCCAGUUGAAGAACUGU
 > mmu-miR-22-3p MIMAT0000531
AAGCUGCCAGUUGAAGAACUGU
A suppressive task in RPE damage by targeting NLRP3, which provides novel insights into the upcoming intervention to retinopathy [136, 207] [82,83,84, 88]
miR-191 GCL, INL, ONL, cone, developing retina Mouse  > hsa-miR-191-5p MIMAT0000440
CAACGGAAUCCCAAAAGCAGCUG
 > mmu-miR-191-5p MIMAT0000221
CAACGGAAUCCCAAAAGCAGCUG
 > hsa-miR-191-3p MIMAT0001618
GCUGCGCUUGGAUUUCGUCCCC
 > mmu-miR-191-3p MIMAT0004542
GCUGCACUUGGAUUUCGUUCCC
ND [101, 107, 120] [154, 165]
miR-191-5p Retina Human  > hsa-miR-191-5p MIMAT0000440
CAACGGAAUCCCAAAAGCAGCUG
 > mmu-miR-191-5p MIMAT0000221
CAACGGAAUCCCAAAAGCAGCUG
ND [136] [82, 83]
miR-127-3p Retina Human  > hsa-miR-127-3p MIMAT0000446
UCGGAUCCGUCUGAGCUUGGCU
 > mmu-miR-127-3p MIMAT0000139
UCGGAUCCGUCUGAGCUUGGCU
ND [136] [21, 82, 83]
miR-27b-3p Retina, RPE Human, in vitro hESC  > hsa-miR-27b-3p MIMAT0000419
UUCACAGUGGCUAAGUUCUGC
 > mmu-miR-27b-3p MIMAT0000126
UUCACAGUGGCUAAGUUCUGC
hESC differentiation into RPE cells [124, 136] [82, 83, 152]
miR-92 Rod, strongly expressed in neonatal retina Mouse  > hsa-miR-92a-2-5p MIMAT0004508
GGGUGGGGAUUUGUUGCAUUAC
 > mmu-miR-92a-2-5p MIMAT0004635
AGGUGGGGAUUGGUGGCAUUAC
 > hsa-miR-92a-3p MIMAT0000092
UAUUGCACUUGUCCCGGCCUGU
 > mmu-miR-92a-3p MIMAT0000539
UAUUGCACUUGUCCCGGCCUG
 > hsa-miR-92a-1-5p MIMAT0004507
AGGUUGGGAUCGGUUGCAAUGCU
 > mmu-miR-92a-1-5p MIMAT0017066
AGGUUGGGAUUUGUCGCAAUGCU
 > hsa-miR-92b-5p MIMAT0004792
AGGGACGGGACGCGGUGCAGUG
 > mmu-miR-92b-5p MIMAT0017278
AGGGACGGGACGUGGUGCAGUGUU
 > hsa-miR-92b-3p MIMAT0003218
UAUUGCACUCGUCCCGGCCUCC
 > mmu-miR-92b-3p MIMAT0004899
UAUUGCACUCGUCCCGGCCUCC
Regulating the survival of rod photoreceptors. Preservation of retinal nerve fiber layer thickness and preservation of RGC function [94, 95, 189, 192] [12, 21, 85]
miR-92a-3p Retina Human, mouse  > hsa-miR-92a-3p MIMAT0000092
UAUUGCACUUGUCCCGGCCUGU
 > mmu-miR-92a-3p MIMAT0000539
UAUUGCACUUGUCCCGGCCUG
Retinal development [133, 136] [3, 82, 84, 172]
miR-92b-3p Retina Human  > hsa-miR-92b-3p MIMAT0003218
UAUUGCACUCGUCCCGGCCUCC
 > mmu-miR-92b-3p MIMAT0004899
UAUUGCACUCGUCCCGGCCUCC
Photoreceptor development and differentiation. RGC development and differentiation [136, 208] [82]
miR-99b RPE, INL, photoreceptors, developing retina Human, mouse  > hsa-miR-99b-5p MIMAT0000689
CACCCGUAGAACCGACCUUGCG
 > mmu-miR-99b-5p MIMAT0000132
CACCCGUAGAACCGACCUUGCG
 > hsa-miR-99b-3p MIMAT0004678
CAAGCUCGUGUCUGUGGGUCCG
 > mmu-miR-99b-3p MIMAT0004525
CAAGCUCGUGUCUGUGGGUCCG
Promoting RPE differentiation [101, 107, 129] [193]
miR-99b-5p Retina Human  > hsa-miR-99b-5p MIMAT0000689
CACCCGUAGAACCGACCUUGCG
 > mmu-miR-99b-5p MIMAT0000132
CACCCGUAGAACCGACCUUGCG
ND [136] [82]
miR-16 Retina, RPE, developing retina ARPE-19, rabbit, mouse  > hsa-miR-16-5p MIMAT0000069
UAGCAGCACGUAAAUAUUGGCG
 > mmu-miR-16-5p MIMAT0000527
UAGCAGCACGUAAAUAUUGGCG
 > ocu-miR-16b-5p MIMAT0048107
UAGCAGCACGUAAAUAUUGGCGU
 > ocu-miR-16a-5p MIMAT0048105
UAGCAGCACGUAAAUACUGGCG
 > hsa-miR-16–1-3p MIMAT0004489
CCAGUAUUAACUGUGCUGCUGA
 > mmu-miR-16–1-3p MIMAT0004625
CCAGUAUUGACUGUGCUGCUGA
 > ocu-miR-16a-3p MIMAT0048106
CCAGUAUUAACUGUGCUGCUGAA
 > hsa-miR-16–2-3p MIMAT0004518
CCAAUAUUACUGUGCUGCUUUA
 > mmu-miR-16–2-3p MIMAT0017018
ACCAAUAUUAUUGUGCUGCUUU
 > ocu-miR-16b-3p MIMAT0048108
ACCAAUAUUAUUGUGCUGCUUUA
Play a role in retinal development. Regulate RPE cell growth, differentiation. Inhibition of insulin resistance in diabetic retina [107, 123, 127, 137] [61, 156, 165, 170, 174]
miR-16-5p Retina, RPE Human, in vitro hESC  > hsa-miR-16-5p MIMAT0000069
UAGCAGCACGUAAAUAUUGGCG
 > mmu-miR-16-5p MIMAT0000527
UAGCAGCACGUAAAUAUUGGCG
hESC differentiation into RPE cells [124, 136] [61, 83, 172, 173]
miR-148a Retina Mouse  > hsa-miR-148a-5p MIMAT0004549
AAAGUUCUGAGACACUCCGACU
 > mmu-miR-148a-5p MIMAT0004617
AAAGUUCUGAGACACUCCGACU
 > hsa-miR-148a-3p MIMAT0000243
UCAGUGCACUACAGAACUUUGU
 > mmu-miR-148a-3p MIMAT0000516
UCAGUGCACUACAGAACUUUGU
ND [106, 107] [193]
miR-148a-3p Retina Human  > hsa-miR-148a-3p MIMAT0000243
UCAGUGCACUACAGAACUUUGU
 > mmu-miR-148a-3p MIMAT0000516
UCAGUGCACUACAGAACUUUGU
Moderates high glucose-induced DR by targeting TGFB2 and FGF2 [136, 209] [83]
miR-125a Retina Mouse  > hsa-miR-125a-5p MIMAT0000443
UCCCUGAGACCCUUUAACCUGUGA
 > mmu-miR-125a-5p MIMAT0000135
UCCCUGAGACCCUUUAACCUGUGA
 > hsa-miR-125a-3p MIMAT0004602
ACAGGUGAGGUUCUUGGGAGCC
 > mmu-miR-125a-3p MIMAT0004528
ACAGGUGAGGUUCUUGGGAGCC
Regulate the transition between early RPCs and late RPCs [92, 125, 185] [61, 156, 174]
miR-125a-5p Retina, RPE, developing retina Human, in vitro hESC, mouse  > hsa-miR-125a-5p MIMAT0000443
UCCCUGAGACCCUUUAACCUGUGA
 > mmu-miR-125a-5p MIMAT0000135
UCCCUGAGACCCUUUAACCUGUGA
hESC differentiation into RPE cells [107, 124, 136] [83, 154]
miR-100 RPE, Müller glia, developing retina Human, mouse  > hsa-miR-100-5p MIMAT0000098
AACCCGUAGAUCCGAACUUGUG
 > mmu-miR-100-5p MIMAT0000655
AACCCGUAGAUCCGAACUUGUG
 > hsa-miR-100-3p MIMAT0004512
CAAGCUUGUAUCUAUAGGUAUG
 > mmu-miR-100-3p MIMAT0017051
ACAAGCUUGUGUCUAUAGGUAU
Promoting RPE differentiation. Upregulated miRNA in RPE during ESC differentiation. Increasing expression from young to adult Müller glia. Regulates mitotic proliferation [66, 107, 125, 129] [153, 154, 156, 159, 165, 174]
miR-100-5p Retina Human  > hsa-miR-100-5p MIMAT0000098
AACCCGUAGAUCCGAACUUGUG
 > mmu-miR-100-5p MIMAT0000655
AACCCGUAGAUCCGAACUUGUG
Upregulated during the differentiation of human embryonic stem cells into RPE Cell [136, 210] [82, 83, 88, 172, 173, 175]
miR-29 Neural retina, ONL Mouse hsa-miR-29a-5p MIMAT0004503
ACUGAUUUCUUUUGGUGUUCAG
 > mmu-miR-29a-5p MIMAT0004631
ACUGAUUUCUUUUGGUGUUCAG
 > hsa-miR-29a-3p MIMAT0000086
UAGCACCAUCUGAAAUCGGUUA
 > mmu-miR-29a-3p MIMAT0000535
UAGCACCAUCUGAAAUCGGUUA
 > hsa-miR-29b-1-5p MIMAT0004514
GCUGGUUUCAUAUGGUGGUUUAGA
 > mmu-miR-29b-1-5p MIMAT0004523
GCUGGUUUCAUAUGGUGGUUUA
 > hsa-miR-29b-3p MIMAT0000100
UAGCACCAUUUGAAAUCAGUGUU
 > mmu-miR-29b-3p MIMAT0000127
UAGCACCAUUUGAAAUCAGUGUU
 > hsa-miR-29c-5p MIMAT0004673
UGACCGAUUUCUCCUGGUGUUC
 > mmu-miR-29c-5p MIMAT0004632
UGACCGAUUUCUCCUGGUGUUC
 > hsa-miR-29c-3p MIMAT0000681
UAGCACCAUUUGAAAUCGGUUA
 > mmu-miR-29c-3p MIMAT0000536
UAGCACCAUUUGAAAUCGGUUA
ND [90, 95] [193]
miR-29a RPCs, Müller glia, MGDP, retina In vivo mouse RPC, in vitro Müller glia, mouse, rat  > hsa-miR-29a-5p MIMAT0004503
ACUGAUUUCUUUUGGUGUUCAG
 > mmu-miR-29a-5p MIMAT0004631
ACUGAUUUCUUUUGGUGUUCAG
 > rno-miR-29a-5p MIMAT0004718
ACUGAUUUCUUUUGGUGUUCAG
 > hsa-miR-29a-3p MIMAT0000086
UAGCACCAUCUGAAAUCGGUUA
 > mmu-miR-29a-3p MIMAT0000535
UAGCACCAUCUGAAAUCGGUUA
 > rno-miR-29a-3p MIMAT0000802
UAGCACCAUCUGAAAUCGGUUA
Regulates the proliferation and differentiation of RPCs. Increased expression in in vitro Müller glia. Increased in MGDPs. Protect RGCs against oxidative injury [66, 107, 111, 146, 211] [193]
miR-29a-3p RPE Human  > hsa-miR-29a-3p MIMAT0000086
UAGCACCAUCUGAAAUCGGUUA
 > mmu-miR-29a-3p MIMAT0000535
UAGCACCAUCUGAAAUCGGUUA
ND [136] [83]
miR-29b RPE, RGC, INL, retina ARPE-19, mouse, rat  > hsa-miR-29b-1-5p MIMAT0004514
GCUGGUUUCAUAUGGUGGUUUAGA
 > mmu-miR-29b-1-5p MIMAT0004523
GCUGGUUUCAUAUGGUGGUUUA
 > rno-miR-29b-1-5p MIMAT0005445
UUUCAUAUGGUGGUUUAGAUUU
 > hsa-miR-29b-3p MIMAT0000100
UAGCACCAUUUGAAAUCAGUGUU
 > mmu-miR-29b-3p MIMAT0000127
UAGCACCAUUUGAAAUCAGUGUU
 > rno-miR-29b-3p MIMAT0000801
UAGCACCAUUUGAAAUCAGUGUU
Regulates TGF-β1-mediated epithelial–mesenchymal transition of RPE cells. Protective effect against the apoptosis of RGCs and cells of the INL [107, 139, 140] [193]
miR-29b-3p Retina Human  > hsa-miR-29b-3p MIMAT0000100
UAGCACCAUUUGAAAUCAGUGUU
 > mmu-miR-29b-3p MIMAT0000127
UAGCACCAUUUGAAAUCAGUGUU
Inhibits cell proliferation and angiogenesis by targeting VEGF-A and PDGFB in retinal microvascular endothelial cells [136, 212] [83]
miR-29c GCL, INL, photoreceptors, retina Human, mouse, rat  > hsa-miR-29c-5p MIMAT0004673
UGACCGAUUUCUCCUGGUGUUC
 > mmu-miR-29c-5p MIMAT0004632
UGACCGAUUUCUCCUGGUGUUC
 > rno-miR-29c-5p MIMAT0003154
UGACCGAUUUCUCCUGGUGUUC
 > hsa-miR-29c-3p MIMAT0000681
UAGCACCAUUUGAAAUCGGUUA
 > mmu-miR-29c-3p MIMAT0000536
UAGCACCAUUUGAAAUCGGUUA
 > rno-miR-29c-3p MIMAT0000803
UAGCACCAUUUGAAAUCGGUUA
May influence neurogliogenic decision in the developing retina [97, 101, 107, 213] [214]
miR-151a-3p Retina Human  > hsa-miR-151a-3p MIMAT0000757
CUAGACUGAAGCUCCUUGAGG
ND [136] [82]
miR-21 Müller glia, RGC In vitro Müller glia, in vitro Retinal microvascular endothelial cells isolated from bovine retina  > hsa-miR-21-5p MIMAT0000076
UAGCUUAUCAGACUGAUGUUGA
 > mmu-miR-21a-5p MIMAT0000530
UAGCUUAUCAGACUGAUGUUGA
 > bta-miR-21-5p MIMAT0003528
UAGCUUAUCAGACUGAUGUUGACU
 > hsa-miR-21-3p MIMAT0004494
CAACACCAGUCGAUGGGCUGU
 > mmu-miR-21a-3p MIMAT0004628
CAACAGCAGUCGAUGGGCUGUC
 > bta-miR-21-3p MIMAT0003745
AACAGCAGUCGAUGGGCUGUCU
 > mmu-miR-21b MIMAT0025121
UAGUUUAUCAGACUGAUAUUUCC
 > mmu-miR-21c MIMAT0025148
UAGCUUAUCAGACUGGUACAA
Increased expression in in vitro Müller glia. Pro-angiogenic role in the retinal microvasculature. Protect RGC-5 cells against oxygen glucose deprivation (OGD-induced) cells injury. Photoreceptor protection [66, 128, 215,216,217] [21, 40, 152,153,154, 156, 159, 160, 163,164,165, 174]
miR-21-5p Retina, RPE Human, in vitro hESC  > hsa-miR-21-5p MIMAT0000076
UAGCUUAUCAGACUGAUGUUGA
 > mmu-miR-21a-5p MIMAT0000530
UAGCUUAUCAGACUGAUGUUGA
hESC differentiation into RPE cells [124, 136] [3, 21, 61, 82,83,84, 88, 172, 173, 175]
miR-101-3p RPE Human, in vitro hESC  > hsa-miR-101-3p MIMAT0000099
UACAGUACUGUGAUAACUGAA
hESC differentiation into RPE cells [124, 136] [156]
miR-146b Developing retina Mouse  > hsa-miR-146b-5p MIMAT0002809
UGAGAACUGAAUUCCAUAGGCUG
 > mmu-miR-146b-5p MIMAT0003475
UGAGAACUGAAUUCCAUAGGCU
 > hsa-miR-146b-3p MIMAT0004766
GCCCUGUGGACUCAGUUCUGGU
 > mmu-miR-146b-3p MIMAT0004826
GCCCUAGGGACUCAGUUCUGGU
Regulates mitotic proliferation. Regulatory role of miR-146b-3p in diabetes related retinal inflammation by suppressing adenosine deaminase (ADA2) [107, 218] [21]
miR-146b-5p RPE Human  > hsa-miR-146b-5p MIMAT0002809
UGAGAACUGAAUUCCAUAGGCUG
 > mmu-miR-146b-5p MIMAT0003475
UGAGAACUGAAUUCCAUAGGCU
ND [136] [82]
miR-486-5p RPE Human  > hsa-miR-486-5p MIMAT0002177
UCCUGUACUGAGCUGCCCCGAG
 > mmu-miR-486a-5p MIMAT0003130
UCCUGUACUGAGCUGCCCCGAG
 > mmu-miR-486b-5p MIMAT0014943
UCCUGUACUGAGCUGCCCCGAG
ND [136] [3, 82, 84, 88]
miR-23b RPE, retina Human, ARPE-19, mouse  > hsa-miR-23b-5p MIMAT0004587
UGGGUUCCUGGCAUGCUGAUUU
 > mmu-miR-23b-5p MIMAT0016980
GGGUUCCUGGCAUGCUGAUUU
 > hsa-miR-23b-3p MIMAT0000418
AUCACAUUGCCAGGGAUUACCAC
 > mmu-miR-23b-3p MIMAT0000125
AUCACAUUGCCAGGGAUUACC
Promoting RPE differentiation. Regulate RPE cell growth, differentiation or development [107, 123, 129] [70, 154, 156, 164]
miR-23b-3p RPE Human, in vitro hESC  > hsa-miR-23b-3p MIMAT0000418
AUCACAUUGCCAGGGAUUACCAC
 > mmu-miR-23b-3p MIMAT0000125
AUCACAUUGCCAGGGAUUACC
hESC differentiation into RPE cells [124, 136] [178]
miR-145 GCL, INL, RPE, Müller glia, retinal endothelial cells In vitro human retinal endothelial cells, in vitro Müller glia, mouse  > hsa-miR-145-5p MIMAT0000437
GUCCAGUUUUCCCAGGAAUCCCU
 > mmu-miR-145a-5p MIMAT0000157
GUCCAGUUUUCCCAGGAAUCCCU
 > mmu-miR-145b MIMAT0025105
GUCCAGUUUUCCCAGGAGACU
 > hsa-miR-145-3p MIMAT0004601
GGAUUCCUGGAAAUACUGUUCU
 > mmu-miR-145a-3p MIMAT0004534
AUUCCUGGAAAUACUGUUCUUG
Reduces high glucose-induced oxidative stress and inflammation in retinal endothelial cells. Increased expression in in vitro Müller glia. Müller glia dedifferentiation [66, 101, 142] [21, 154, 156, 159, 161, 164, 165]
miR-145-5p RPE, retina Human  > hsa-miR-145-5p MIMAT0000437
GUCCAGUUUUCCCAGGAAUCCCU
 > mmu-miR-145a-5p MIMAT0000157
GUCCAGUUUUCCCAGGAAUCCCU
ND [136] [83, 153, 172, 175]
miR-451a RPE, retina Human  > hsa-miR-451a MIMAT0001631
AAACCGUUACCAUUACUGAGUU
 > mmu-miR-451a MIMAT0001632
AAACCGUUACCAUUACUGAGUU
miR-451a/ATF2 plays a critical role in the regulation of proliferation and migration in RPE cells via regulation of mitochondrial function [136, 219] [83, 174]
miR-150 Retina Mouse  > hsa-miR-150-5p MIMAT0000451
UCUCCCAACCCUUGUACCAGUG
 > mmu-miR-150-5p MIMAT0000160
UCUCCCAACCCUUGUACCAGUG
 > hsa-miR-150-3p MIMAT0004610
CUGGUACAGGCCUGGGGGACAG
 > mmu-miR-150-3p MIMAT0004535
CUGGUACAGGCCUGGGGGAUAG
Suppression of pathological retinal neovascularization [151] [154, 160]
miR-133b Retina, amacrine cells Rat  > hsa-miR-133b MIMAT0000770
UUUGGUCCCCUUCAACCAGCUA
 > mmu-miR-133b-3p MIMAT0000769
UUUGGUCCCCUUCAACCAGCUA
 > rno-miR-133b-3p MIMAT0003126
UUUGGUCCCCUUCAACCAGCUA
 > mmu-miR-133b-5p MIMAT0017083
GCUGGUCAAACGGAACCAAGUC
 > rno-miR-133b-5p MIMAT0017205
GCUGGUCAAACGGAACCAAGU
Differentiation and death of RPCs. Connectivity and plasticity of retinal cells. Control of the maturation and function of dopaminergic amacrine cells. Plays an important protective role in RGCs apoptosis through MAPK/Erk2 signaling pathway [93, 220, 221] [40, 42, 61, 156, 157, 163, 164, 166, 169, 171]
miR-196a RPCs Xenopus laevis 196a: there is no information about this Xenopus laevis miRNA in miRBase
 > hsa-miR-196a-5p MIMAT0000226
UAGGUAGUUUCAUGUUGUUGGG
 > hsa-miR-196a-1-3p MIMAT0037307
CAACAACAUUAAACCACCCGA
Proliferation, differentiation and death of RPCs [93] [61, 83, 174]
miR-222 RPCs, RPE Human, Xenopus laevis, rabbit  > hsa-miR-222-5p MIMAT0004569
CUCAGUAGCCAGUGUAGAUCCU
 > mmu-miR-222-5p MIMAT0017061
CUCAGUAGCCAGUGUAGAUCC
 > xla-miR-222-5p MIMAT0046544
GCUCAGUAAUCAGUGUAGAUCC
 > hsa-miR-222-3p MIMAT0000279
AGCUACAUCUGGCUACUGGGU
 > mmu-miR-222-3p MIMAT0000670
AGCUACAUCUGGCUACUGGGUCU
 > xla-miR-222-3p MIMAT0046545
AGCUACAUCUGGCUACUGGGUCU
Differentiation and death of RPCs. Highly expressed at early developmental stages in the embryonic retina. Upregulated miRNA in RPE during ESC differentiation. Prevent the progression of retinal degeneration [16, 93, 125, 144, 222] [82, 83, 154, 165, 173, 174]
miR-214 RPCs, RPE, Müller glia Human, Xenopus laevis, in vitro Müller glia, mouse  > hsa-miR-214-5p MIMAT0004564
UGCCUGUCUACACUUGCUGUGC
 > mmu-miR-214-5p MIMAT0004664
UGCCUGUCUACACUUGCUGUGC
 > xla-miR-214-5p MIMAT0046534
GCCUGUCUACACUUGCUGUGC
 > hsa-miR-214-3p MIMAT0000271
ACAGCAGGCACAGACAGGCAGU
 > mmu-miR-214-3p MIMAT0000661
ACAGCAGGCACAGACAGGCAGU
 > xla-miR-214-3p MIMAT0046535
ACAGCAGGCACAGACAGGCAG
 > hsa-miR-24–2-5p MIMAT0004497
UGCCUACUGAGCUGAAACACAG
 > mmu-miR-24–1-5p MIMAT0000218
GUGCCUACUGAGCUGAUAUCAGU
 > xla-miR-24a-5p MIMAT0046550
GUGCCUACUGAACUGAUAUCAGU
Differentiation and death of RPCs. Highly expressed at early developmental stages in the embryonic retina. Upregulated miRNA in RPE during ESC differentiation. Increased expression in in vitro Müller glia. May act directly to either block pathological neovascularization or prevent hyperoxia-induced vaso-obliteration [66, 93, 125, 128, 144, 223] [154]
miR-24 RPE, GCL,INL, retina Human, ARPE-19, in vitro hESC, mouse, rat  > hsa-miR-24–2-5p MIMAT0004497
UGCCUACUGAGCUGAAACACAG
 > mmu-miR-24–2-5p MIMAT0005440
GUGCCUACUGAGCUGAAACAGU
 > hsa-miR-24-3p MIMAT0000080
UGGCUCAGUUCAGCAGGAACAG
 > mmu-miR-24-3p MIMAT0000219
UGGCUCAGUUCAGCAGGAACAG
 > hsa-miR-24–1-5p MIMAT0000079
UGCCUACUGAGCUGAUAUCAGU
 > mmu-miR-24–1-5p MIMAT0000218
GUGCCUACUGAGCUGAUAUCAGU
Promoting RPE differentiation. hESC differentiation into RPE cells. Functions as an important regulator of cell death during retinal development by repressing an apoptotic program. Preserve retina from degeneration in rats by downregulating chitinase-3-like protein 1 [101, 107, 123, 124, 129, 224, 225] [83, 154, 172,173,174]
miR-24a RPCs, RPE Xenopus laevis,  > hsa-miR-24-3p MIMAT0000080
UGGCUCAGUUCAGCAGGAACAG
 > mmu-miR-24-3p MIMAT0000219
UGGCUCAGUUCAGCAGGAACAG
 > xla-miR-24a-3p MIMAT0046551
UGGCUCAGUUCAGCAGGAACAG
 > xla-miR-24b-3p MIMAT0011146
UGGCUCAGUUCAGCAGGAC
Repression of apoptosis in the developing neural retina. Differentiation and death of RPCs. Inhibition during development makes a reduction in eye size due to a serious increase in apoptosis in the retina, whereas overexpression is adequate to prevent apoptosis. Regulate RPE cell growth, differentiation or development. Morpholino-induced inhibition in Xenopus leads to apoptosis of RPCs [93, 104, 145] [193]
miR-155 RPCs, retina Mouse, Xenopus laevis, zebrafish  > hsa-miR-155-5p MIMAT0000646
UUAAUGCUAAUCGUGAUAGGGGUU
 > mmu-miR-155-5p MIMAT0000165
UUAAUGCUAAUUGUGAUAGGGGU
 > dre-miR-155 MIMAT0001851
UUAAUGCUAAUCGUGAUAGGGG
 > hsa-miR-155-3p MIMAT0004658
CUCCUACAUAUUAGCAUUAACA
 > mmu-miR-155-3p MIMAT0016993
CUCCUACCUGUUAGCAUUAAC
155: there is no information about this Xenopus laevis miRNA in miRBase
Differentiation and death of RPCs. Highly expressed at early developmental stages in the embryonic retina. Potentially beneficial in retinal neovascularization therapy [93, 99, 144, 147] [61, 152, 158]
miR-210 Retina Mouse  > hsa-miR-210-5p MIMAT0026475
AGCCCCUGCCCACCGCACACUG
 > mmu-miR-210-5p MIMAT0017052
AGCCACUGCCCACCGCACACUG
 > hsa-miR-210-3p MIMAT0000267
CUGUGCGUGUGACAGCGGCUGA
 > mmu-miR-210-3p MIMAT0000658
CUGUGCGUGUGACAGCGGCUGA
Function during retinal development [94, 226] [40, 156, 159]
miR-17 Retina, GCL,INL, developing retina Mouse, rabbit  > hsa-miR-17-5p MIMAT0000070
CAAAGUGCUUACAGUGCAGGUAG
 > mmu-miR-17-5p MIMAT0000649
CAAAGUGCUUACAGUGCAGGUAG
 > ocu-miR-17-5p MIMAT0048109
CAAAGUGCUUACAGUGCAGGUAG
 > hsa-miR-17-3p MIMAT0000071
ACUGCAGUGAAGGCACUUGUAG
 > mmu-miR-17-3p MIMAT0000650
ACUGCAGUGAGGGCACUUGUAG
 > ocu-miR-17-3p MIMAT0048110
ACUGCAGUGAAGGCACUUGUAG
Acts in retinal development. Works as a key regulator of the neurogenic-to-gliogenic transition in neural progenitor cells. Regulates the proliferation and differentiation of RPCs. Regulates mitotic proliferation [66, 101, 107, 127, 150] [12, 21, 85, 156, 163, 174]
miR-410 Retina, GCL, INL Mouse  > hsa-miR-410-5p MIMAT0026558
AGGUUGUCUGUGAUGAGUUCG
 > mmu-miR-410-5p MIMAT0017172
AGGUUGUCUGUGAUGAGUUCG
 > hsa-miR-410-3p MIMAT0002171
AAUAUAACACAGAUGGCCUGU
 > mmu-miR-410-3p MIMAT0001091
AAUAUAACACAGAUGGCCUGU
Efficiently downregulate VEGF-A expression. Prevent retinal angiogenesis and effectively treat Retinal Neovascularization [101, 227] [159, 161]
miR-27a RPE, GCL, INL, retina Human, in vitro hESC, mouse  > hsa-miR-27a-5p MIMAT0004501
AGGGCUUAGCUGCUUGUGAGCA
 > mmu-miR-27a-5p MIMAT0004633
AGGGCUUAGCUGCUUGUGAGCA
 > hsa-miR-27a-3p MIMAT0000084
UUCACAGUGGCUAAGUUCCGC
 > mmu-miR-27a-3p MIMAT0000537
UUCACAGUGGCUAAGUUCCGC
Promoting RPE differentiation. hESC differentiation into RPE cells [101, 107, 124, 129] [61]
miR-18a Retina, developing retina Human, rabbit, zebrafish, mouse  > hsa-miR-18a-5p MIMAT0000072
UAAGGUGCAUCUAGUGCAGAUAG
 > mmu-miR-18a-5p MIMAT0000528
UAAGGUGCAUCUAGUGCAGAUAG
 > ocu-miR-18a-5p MIMAT0048111
UAAGGUGCAUCUAGUGCAGAUAG
 > dre-miR-18a MIMAT0001779
UAAGGUGCAUCUAGUGCAGAUA
 > hsa-miR-18a-3p MIMAT0002891
ACUGCCCUAAGUGCUCCUUCUGG
 > mmu-miR-18a-3p MIMAT0004626
ACUGCCCUAAGUGCUCCUUCUG
 > ocu-miR-18a-3p MIMAT0048112
ACUGCCCUAAGUGCUCCUUCUGGC
Sensory perception of light. Rhodopsin-like receptor activity. Regulates NeuroD and photoreceptor differentiation in the Retina. Regulates mitotic proliferation [107, 127, 149] [12, 85]
miR-130b Retina, developing retina Rabbit, mouse  > hsa-miR-130b-5p MIMAT0004680
ACUCUUUCCCUGUUGCACUAC
 > mmu-miR-130b-5p MIMAT0004583
ACUCUUUCCCUGUUGCACUACU
 > ocu-miR-130b-5p MIMAT0048219
ACUCUUUCCCUGUUGCACUACU
 > hsa-miR-130b-3p MIMAT0000691
CAGUGCAAUGAUGAAAGGGCAU
 > mmu-miR-130b-3p MIMAT0000387
CAGUGCAAUGAUGAAAGGGCAU
 > ocu-miR-130b-3p MIMAT0048220
CAGUGCAAUGAUGAAAGGGCAU
Play a role in retinal development [107, 127] [193]
miR-20a Retina, RPE, developing retina In vitro hESC, mouse, rabbit  > hsa-miR-20a-5p MIMAT0000075
UAAAGUGCUUAUAGUGCAGGUAG
 > mmu-miR-20a-5p MIMAT0000529
UAAAGUGCUUAUAGUGCAGGUAG
 > ocu-miR-20a-5p MIMAT0048120
UAAAGUGCUUAUAGUGCAGGUAG
 > hsa-miR-20a-3p MIMAT0004493
ACUGCAUUAUGAGCACUUAAAG
 > mmu-miR-20a-3p MIMAT0004627
ACUGCAUUACGAGCACUUAAAG
 > ocu-miR-20a-3p MIMAT0048121
ACUGCAUUAUGAGCACUUAAAGU
Play a role in retinal development. hESC differentiation into RPE cells. Regulates mitotic proliferation [107, 124, 127] [12, 85, 163]
miR-19a Retina, INL, GCL, RPE, developing retina In vitro hESC, rabbit, zebrafish, mouse  > hsa-miR-19a-5p MIMAT0004490
AGUUUUGCAUAGUUGCACUACA
 > mmu-miR-19a-5p MIMAT0004660
UAGUUUUGCAUAGUUGCACUAC
 > ocu-miR-19a-5p MIMAT0048115
AGUUUUGCAUAGUUGCACUAC
 > dre-miR-19a-5p MIMAT0003398
CUAGUUUUGCAUAGUUGCACUA
 > hsa-miR-19a-3p MIMAT0000073
UGUGCAAAUCUAUGCAAAACUGA
 > mmu-miR-19a-3p MIMAT0000651
UGUGCAAAUCUAUGCAAAACUGA
 > ocu-miR-19a-3p MIMAT0048116
UGUGCAAAUCUAUGCAAAACUGA
 > dre-miR-19a-3p MIMAT0001782
UGUGCAAAUCUAUGCAAAACUGA
Play a role in retinal development. Regulates mitotic proliferation. hESC differentiation into RPE cells. Its intravitreal injection advances axon regeneration after optic nerve crush in adult mice, and it increases axon extension in RGCs isolated from aged human donors [99, 107, 124, 127, 228] [12, 21, 40, 70, 85, 156, 163, 169]
miR-93 Retina, developing retina Rabbit, mouse  > hsa-miR-93-5p MIMAT0000093
CAAAGUGCUGUUCGUGCAGGUAG
 > mmu-miR-93-5p MIMAT0000540
CAAAGUGCUGUUCGUGCAGGUAG
 > ocu-miR-93-5p MIMAT0048176
CAAAGUGCUGUUCGUGCAGGUAG
 > hsa-miR-93-3p MIMAT0004509
ACUGCUGAGCUAGCACUUCCCG
 > mmu-miR-93-3p MIMAT0004636
ACUGCUGAGCUAGCACUUCCCG
 > ocu-miR-93-3p MIMAT0048177
ACUGCUGAGCUAGCACUUCCCGA
Play a role in retinal development. Regulates mitotic proliferation. Overexpression significantly diminished microglial proliferation migration and cytokine release which was associated with a decrease in loss of RGCs [107, 127, 229] [193]
miR-93-5p RGC Mouse, rat  > hsa-miR-93-5p MIMAT0000093
CAAAGUGCUGUUCGUGCAGGUAG
 > mmu-miR-93-5p MIMAT0000540
CAAAGUGCUGUUCGUGCAGGUAG
 > rno-miR-93-5p MIMAT0000817
CAAAGUGCUGUUCGUGCAGGUAG
Retinal development, (Axon guidance). Upregulation of miR-93-5p binding with PTEN suppressed the autophagy of RGCs through AKT/mTOR pathway in NMDA-induced glaucoma [133, 230] [83]
miR-15b Retina, GCL, INL, RPE, developing retina ARPE-19, mouse, rabbit  > hsa-miR-15b-5p MIMAT0000417
UAGCAGCACAUCAUGGUUUACA
 > mmu-miR-15b-5p MIMAT0000124
UAGCAGCACAUCAUGGUUUACA
 > ocu-miR-15b-5p MIMAT0048103
UAGCAGCACAUCAUGGUUUACA
 > hsa-miR-15b-3p MIMAT0004586
CGAAUCAUUAUUUGCUGCUCUA
 > mmu-miR-15b-3p MIMAT0004521
CGAAUCAUUAUUUGCUGCUCUA
 > ocu-miR-15b-3p MIMAT0048104
CGAAUCAUAAUUUGCUGCUCUA
Play a role in retinal development. Participates in the inhibition of insulin resistance in diabetic retina. Regulates mitotic proliferation [101, 107, 127, 137] [61, 83]
miR-19b Retina, developing retina Mouse, rabbit  > hsa-miR-19b-2-5p MIMAT0004492
AGUUUUGCAGGUUUGCAUUUCA
 > mmu-miR-19b-2-5p MIMAT0017010
AGUUUUGCAGAUUUGCAGUUCAGC
 > ocu-miR-19b-2-5p MIMAT0048119
AGUUUUGCAGGUUUGCAUUUC
 > hsa-miR-19b-3p MIMAT0000074
UGUGCAAAUCCAUGCAAAACUGA
 > mmu-miR-19b-3p MIMAT0000513
UGUGCAAAUCCAUGCAAAACUGA
 > ocu-miR-19b-3p MIMAT0048118
UGUGCAAAUCCAUGCAAAACUGA
 > hsa-miR-19b-1-5p MIMAT0004491
AGUUUUGCAGGUUUGCAUCCAGC
 > mmu-miR-19b-1-5p MIMAT0017065
AGUUUUGCAGGUUUGCAUCCAGC
 > ocu-miR-19b-5p MIMAT0048117
AGUUUUGCAGGUUUGCAUCCAGC
Play a role in retinal development. Regulates mitotic proliferation [107, 127] [12, 85, 163, 174]
miR-19b-3p RPE In vitro hESC  > hsa-miR-19b-3p MIMAT0000074
UGUGCAAAUCCAUGCAAAACUGA
 > mmu-miR-19b-3p MIMAT0000513
UGUGCAAAUCCAUGCAAAACUGA
hESC differentiation into RPE cells [124] [83, 172]
miR-151b RPE Human  > hsa-miR-151b MIMAT0010214
UCGAGGAGCUCACAGUCU
Upregulated in RPE during ESC differentiation [125] [231]
miR-25 MGDP cells, developing retina Mouse  > hsa-miR-25-5p MIMAT0004498
AGGCGGAGACUUGGGCAAUUG
 > mmu-miR-25-5p MIMAT0017049
AGGCGGAGACUUGGGCAAUUGC
 > hsa-miR-25-3p MIMAT0000081
CAUUGCACUUGUCUCGGUCUGA
 > mmu-miR-25-3p MIMAT0000652
CAUUGCACUUGUCUCGGUCUGA
Reprogram mouse Müller glia into neural progenitors in vitro. Regulates mitotic proliferation [107, 108] [83, 172]
miR-132 RGC, CMZ, INL, GCL, RPE, retina Mouse, zebrafish  > hsa-miR-132-5p MIMAT0004594
ACCGUGGCUUUCGAUUGUUACU
 > mmu-miR-132-5p MIMAT0016984
AACCGUGGCUUUCGAUUGUUAC
 > dre-miR-132-5p MIMAT0003403
ACCGUGGCAUUAGAUUGUUACU
 > hsa-miR-132-3p MIMAT0000426
UAACAGUCUACAGCCAUGGUCG
 > mmu-miR-132-3p MIMAT0000144
UAACAGUCUACAGCCAUGGUCG
 > dre-miR-132-3p MIMAT0001829
UAACAGUCUACAGCCAUGGUCG
Branching of RGC axons [65, 99, 101, 107, 232] [154, 156, 160, 167]
miR-449 RPE Zebrafish 449: there is no information about this zebrafish miRNA in miRBase
 > hsa-miR-449a MIMAT0001541
UGGCAGUGUAUUGUUAGCUGGU
 > hsa-miR-449c-5p MIMAT0010251
UAGGCAGUGUAUUGCUAGCGGCUGU
 > hsa-miR-449c-3p MIMAT0013771
UUGCUAGUUGCACUCCUCUCUGU
 > hsa-miR-449b-5p MIMAT0003327
AGGCAGUGUAUUGUUAGCUGGC
 > hsa-miR-449b-3p MIMAT0009203
CAGCCACAACUACCCUGCCACU
Consistently upregulated along with the RPE differentiation [126] [174]
miR-361 Retina Human  > hsa-miR-361-5p MIMAT0000703
UUAUCAGAAUCUCCAGGGGUAC
 > mmu-miR-361-5p MIMAT0000704
UUAUCAGAAUCUCCAGGGGUAC
 > hsa-miR-361-3p MIMAT0004682
UCCCCCAGGUGUGAUUCUGAUUU
 > mmu-miR-361-3p MIMAT0017075
UCCCCCAGGUGUGAUUCUGAUUUGU
Overexpression of miR-361-5p might act as a suppressor in retinoblastoma. miR-361-3p functions as a tumor suppressor in the carcinogenesis and progression of retinoblastoma [97, 233, 234] [154]
miR-130a GCL, INL, RPE, developing retina Mouse  > hsa-miR-130a-5p MIMAT0004593
GCUCUUUUCACAUUGUGCUACU
 > mmu-miR-130a-5p MIMAT0016983
GCUCUUUUCACAUUGUGCUACU
 > hsa-miR-130a-3p MIMAT0000425
CAGUGCAAUGUUAAAAGGGCAU
 > mmu-miR-130a-3p MIMAT0000141
CAGUGCAAUGUUAAAAGGGCAU
Regulates mitotic proliferation [101, 107] [156, 160, 167]
miR-130a-3p Retina Mouse  > hsa-miR-130a-3p MIMAT0000425
CAGUGCAAUGUUAAAAGGGCAU
 > mmu-miR-130a-3p MIMAT0000141
CAGUGCAAUGUUAAAAGGGCAU
Retinal development [133] [83]
miR-320 RPE, developing retina ARPE-19, mouse  > hsa-miR-320a-5p MIMAT0037311
GCCUUCUCUUCCCGGUUCUUCC
 > mmu-miR-320-5p MIMAT0017057
GCCUUCUCUUCCCGGUUCUUCC
 > hsa-miR-320a-3p MIMAT0000510
AAAAGCUGGGUUGAGAGGGCGA
 > mmu-miR-320-3p MIMAT0000666
AAAAGCUGGGUUGAGAGGGCGA
 > hsa-miR-320b MIMAT0005792
AAAAGCUGGGUUGAGAGGGCAA
 > hsa-miR-320d MIMAT0006764
AAAAGCUGGGUUGAGAGGA
 > hsa-miR-320e MIMAT0015072
AAAGCUGGGUUGAGAAGG
 > hsa-miR-320c MIMAT0005793
AAAAGCUGGGUUGAGAGGGU
Regulate RPE cell growth, differentiation or development [107, 123] [3, 83, 154]
miR-149 GCL, INL, RPE Mouse  > hsa-miR-149-5p MIMAT0000450
UCUGGCUCCGUGUCUUCACUCCC
 > mmu-miR-149-5p MIMAT0000159
UCUGGCUCCGUGUCUUCACUCCC
 > hsa-miR-149-3p MIMAT0004609
AGGGAGGGACGGGGGCUGUGC
 > mmu-miR-149-3p MIMAT0016990
GAGGGAGGGACGGGGGCGGUGC
ND [101] [154]
miR-296-5p GCL, INL, RPE Mouse  > hsa-miR-296-5p MIMAT0000690
AGGGCCCCCCCUCAAUCCUGU
 > mmu-miR-296-5p MIMAT0000374
AGGGCCCCCCCUCAAUCCUGU
ND [101] [154]
miR-328 GCL, INL, RPE Mouse  > hsa-miR-328-5p MIMAT0026486
GGGGGGGCAGGAGGGGCUCAGGG
 > mmu-miR-328-5p MIMAT0017030
GGGGGGCAGGAGGGGCUCAGGG
 > hsa-miR-328-3p MIMAT0000752
CUGGCCCUCUCUGCCCUUCCGU
 > mmu-miR-328-3p MIMAT0000565
CUGGCCCUCUCUGCCCUUCCGU
Promotion of RPE proliferation [101, 235] [166]
miR-294 GCL, INL, RPE Mouse  > mmu-miR-294-5p MIMAT0004574
ACUCAAAAUGGAGGCCCUAUCU
 > mmu-miR-294-3p MIMAT0000372
AAAGUGCUUCCCUUUUGUGUGU
294: there is no information about this human miRNA in miRBase
May keep Müller cells pluripotency [101, 236] [156]
miR-221 GCL, INL Mouse  > hsa-miR-221-5p MIMAT0004568
ACCUGGCAUACAAUGUAGAUUU
 > mmu-miR-221-5p MIMAT0017060
ACCUGGCAUACAAUGUAGAUUUCUGU
 > hsa-miR-221-3p MIMAT0000278
AGCUACAUUGUCUGCUGGGUUUC
 > mmu-miR-221-3p MIMAT0000669
AGCUACAUUGUCUGCUGGGUUUC
ND [101] [3, 40, 83, 153, 154, 156, 157, 165, 173, 174]
miR-15a GCL, developing retina Mouse  > hsa-miR-15a-5p MIMAT0000068
UAGCAGCACAUAAUGGUUUGUG
 > mmu-miR-15a-5p MIMAT0000526
UAGCAGCACAUAAUGGUUUGUG
 > hsa-miR-15a-3p MIMAT0004488
CAGGCCAUAUUGUGCUGCCUCA
 > mmu-miR-15a-3p MIMAT0004624
CAGGCCAUACUGUGCUGCCUCA
Anti-inflammatory and anti-angiogenic action of miR-15a in DR [101, 107, 237] [61]
miR-15a-5p RPE In vitro hESC  > hsa-miR-15a-5p MIMAT0000068
UAGCAGCACAUAAUGGUUUGUG
 > mmu-miR-15a-5p MIMAT0000526
UAGCAGCACAUAAUGGUUUGUG
hESC differentiation into RPE cells [124] [83]
miR-223 GCL, INL Mouse, zebrafish  > hsa-miR-223-5p MIMAT0004570
CGUGUAUUUGACAAGCUGAGUU
 > mmu-miR-223-5p MIMAT0017056
CGUGUAUUUGACAAGCUGAGUUG
 > hsa-miR-223-3p MIMAT0000280
UGUCAGUUUGUCAAAUACCCCA
 > mmu-miR-223-3p MIMAT0000665
UGUCAGUUUGUCAAAUACCCCA
 > dre-miR-223 MIMAT0001290
UGUCAGUUUGUCAAAUACCCC
Necessary for maintaining normal retinal function as well as regulating inflammation in microglia and macrophages. Key role in zebrafish optic nerve regeneration. Upregulation of miR-223 in RGCs via intravitreal injection protected RGC axons in the optic nerve from degeneration [101, 238,239,240,241] [21, 61, 70, 156, 158, 174]
miR-497 GCL, INL Mouse  > hsa-miR-497-5p MIMAT0002820
CAGCAGCACACUGUGGUUUGU
 > mmu-miR-497a-5p MIMAT0003453
CAGCAGCACACUGUGGUUUGUA
 > mmu-miR-497b MIMAT0031404
CACCACAGUGUGGUUUGGACGUGG
 > hsa-miR-497-3p MIMAT0004768
CAAACCACACUGUGGUGUUAGA
 > mmu-miR-497a-3p MIMAT0017247
CAAACCACACUGUGGUGUUAG
Functions as a tumor suppressor in the carcinogenesis and progression of retinoblastoma via targeting VEGF-A. Metformin may obstruct the VEGF-A protein translation via inducing a VEGF-A-targeting microRNA, microRNA-497a-5p, resulting in reduced retina neovascularization [101, 242, 243] [176]
miR-28 Retina Mouse  > hsa-miR-28-5p MIMAT0000085
AAGGAGCUCACAGUCUAUUGAG
 > mmu-miR-28a-5p MIMAT0000653
AAGGAGCUCACAGUCUAUUGAG
 > mmu-miR-28c MIMAT0019339
AGGAGCUCACAGUCUAUUGA
 > mmu-miR-28b MIMAT0019354
AGGAGCUCACAAUCUAUUUAG
 > hsa-miR-28-3p MIMAT0004502
CACUAGAUUGUGAGCUCCUGGA
 > mmu-miR-28a-3p MIMAT0004661
CACUAGAUUGUGAGCUGCUGGA
Inhibits differentiation of MGDPs toward a photoreceptor lineage fate. Potentially regulates the photoreceptor lineage commitment of MGDPs [60, 141] [82]
miR-99a Müller glia Mouse  > hsa-miR-99a-5p MIMAT0000097
AACCCGUAGAUCCGAUCUUGUG
 > mmu-miR-99a-5p MIMAT0000131
AACCCGUAGAUCCGAUCUUGUG
 > hsa-miR-99a-3p MIMAT0004511
CAAGCUCGCUUCUAUGGGUCUG
 > mmu-miR-99a-3p MIMAT0016981
CAAGCUCGUUUCUAUGGGUCU
Increasing expression from young to adult Müller glia [66] [174]
miR-199a Müller glia In vitro Müller glia  > hsa-miR-199a-5p MIMAT0000231
CCCAGUGUUCAGACUACCUGUUC
 > mmu-miR-199a-5p MIMAT0000229
CCCAGUGUUCAGACUACCUGUUC
 > hsa-miR-199a-3p MIMAT0000232
ACAGUAGUCUGCACAUUGGUUA
 > mmu-miR-199a-3p MIMAT0000230
ACAGUAGUCUGCACAUUGGUUA
Increased expression in in vitro Müller glia [66] [61, 83, 154, 156, 161, 165, 175]
miR-140 Retina Mouse  > hsa-miR-140-5p MIMAT0000431
CAGUGGUUUUACCCUAUGGUAG
 > mmu-miR-140-5p MIMAT0000151
CAGUGGUUUUACCCUAUGGUAG
 > hsa-miR-140-3p MIMAT0004597
UACCACAGGGUAGAACCACGG
 > mmu-miR-140-3p MIMAT0000152
UACCACAGGGUAGAACCACGG
MiR-140-5p suppresses retinoblastoma cell growth by inhibiting c-Met/AKT/mTOR pathway. Intravitreal delivery offers protection in preventing oxidative stress mediated retinal ischemia–reperfusion injury [106, 107, 244, 245] [162]
miR-151-5p Retina Mouse  > hsa-miR-151a-5p MIMAT0004697
UCGAGGAGCUCACAGUCUAGU
 > mmu-miR-151-5p MIMAT0004536
UCGAGGAGCUCACAGUCUAGU
ND [107] [154, 156]
miR-195 Mature retina Mouse  > hsa-miR-195-5p MIMAT0000461
UAGCAGCACAGAAAUAUUGGC
 > mmu-miR-195a-5p MIMAT0000225
UAGCAGCACAGAAAUAUUGGC
 > hsa-miR-195-3p MIMAT0004615
CCAAUAUUGGCUGUGCUGCUCC
 > mmu-miR-195a-3p MIMAT0017000
CCAAUAUUGGCUGUGCUGCUCC
 > mmu-miR-195b MIMAT0025076
UAGCAGCACAGAAAUAGUAGAA
ND [107] [83, 165]
miR-423-5p Developing retina Mouse  > hsa-miR-423-5p MIMAT0004748
UGAGGGGCAGAGAGCGAGACUUU
 > mmu-miR-423-5p MIMAT0004825
UGAGGGGCAGAGAGCGAGACUUU
ND [107] [3, 82]
miR-374 Developing retina Mouse  > hsa-miR-374a-5p MIMAT0000727
UUAUAAUACAACCUGAUAAGUG
 > hsa-miR-374a-3p MIMAT0004688
CUUAUCAGAUUGUAUUGUAAUU
 > hsa-miR-374b-5p MIMAT0004955
AUAUAAUACAACCUGCUAAGUG
 > mmu-miR-374b-5p MIMAT0003727
AUAUAAUACAACCUGCUAAGUG
 > hsa-miR-374b-3p MIMAT0004956
CUUAGCAGGUUGUAUUAUCAUU
 > mmu-miR-374b-3p MIMAT0003728
GGUUGUAUUAUCAUUGUCCGAG
 > hsa-miR-374c-5p MIMAT0018443
AUAAUACAACCUGCUAAGUGCU
 > mmu-miR-374c-5p MIMAT0014953
AUAAUACAACCUGCUAAGUG
 > hsa-miR-374c-3p MIMAT0022735
CACUUAGCAGGUUGUAUUAUAU
 > mmu-miR-374c-3p MIMAT0014954
ACUUAGCAGGUUGUAUUAU
miR‐374 can work with miR‐23a to cooperatively regulate the expression of Brn3b, thereby influencing RGC development. miR‐374a is a negative regulator of Fas death receptor which is able to enhance the cell survival and protect RPE cells against oxidative conditions [107, 202, 246, 247] [83]
  1. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment of photoreceptors; OS, outer segment of photoreceptors; RPE, retinal pigment epithelium; MGDP, Müller glia-derived progenitor cells; CMZ, ciliary margin zone; RPC, retinal progenitor cells; RSC, retinal stem cells; ESC, embryonic stem cells; hESC, human embryonic stem cells; hPESC, human parthenogenetic embryonic stem cells; AMD, age-related macular degeneration; DR, diabetic retinopathy; ND, not defined. Human: Homo sapiens (hsa); Medaka fish: Oryzias latipes (ola); Mouse: Mus musculus (mmu); Rabbit: Oryctolagus cuniculus (ocu); Rat: Rattus norvegicus (rno); Xenopus laevis (xla); Zebrafish: Danio rerio (dre). All miRNA sequences are taken from www.mirbase.org