Skip to main content

Table 1 Primers used for real-time PCR

From: Hepatic progenitor cells promote the repair of schistosomiasis liver injury by inhibiting IL-33 secretion in mice

Genes Primer Sequence(5′–3′)
GAPDH Forward primer ACTCCACTCACGGCAAATTC
Reverse primer TCTCCATGGTGGTGAAGACA
HGF Forward primer CCAGAGGTACGCTACGAAGT
Reverse primer CTGTGTGATCCATGGGACCT
IL-6 Forward primer GACTGATGCTGGTGACAACC
Reverse primer AGACAGGTCTGTTGGGAGTG
α-SMA Forward primer CACAGCCCTGGTGTGCGACAAT
Reverse primer TTGCTCTGGGCTTCATCCCCCA
Collagen-I Forward primer TCCTGCGCCTAATGTCCACCGA
Reverse primer AAGCGACTGTTGCCTTCGCCTC
IL-33 Forward primer ACACAGTCTCCTGCCTCCCT
Reverse primer CCACACCGTCGCCTGATTGA
Albumin Forward primer GCCCACTGTCTTAGTGAGGT
Reverse primer ATACAAGAACGTGCCCAGGA