Skip to main content

Table 1 Primer sequences

From: A novel minimally invasive OFM technique with orthotopic transplantation of hUC-MSCs and in vivo monitoring of liver metabolic microenvironment in liver fibrosis treatment

Gene name Primer sequences (5′-3′)
α-SMA GAACACGGCATCATCACCAAC
CTCCAGAGTCCAGCACAATACC
Collagen I GCTCCTCTTAGGGGCCACT
CCACGTCTCACCATTGGGG
TGF-β GCCCTGGATACCAACTATTGC
GCAGGAGCGCACAATCATGTT
β-Actin GGCTGTATTCCCCTCCATCG
CCAGTTGGTAACAATGCCATGT