Skip to main content

Table 1 Primer Sequences (Reverse Transcription Polymerase Chain Reaction)

From: Activation of the EGFR-PI3K-CaM pathway by PRL-1-overexpressing placenta-derived mesenchymal stem cells ameliorates liver cirrhosis via ER stress-dependent calcium

Type Gene Sequence (5’–3’) Tm (℃) Accession no
Calcium channel SERCA2b F: 5’- CCAGTCGATTCTTACAGGTG -3’
R: 5’- GCGATGTTTGTGCCAGAAAA -3’
56 NM_001110823.2
IP3R F: 5’- GGAGCCTCTGGTGAAAACGA -3’
R: 5’- CACCCATGTTCCTCAGCAGT -3’
59 NM_001007235.2
GRP75 F: 5’- TGATGCCAATGGGATTGTGC -3’
R: 5’- CTGCTTCAACACGTTCCTTC -3’
58 NM_001100658.2
CaM F: 5’- GTGAGGCATTCCGAGTCTTT -3’
R: 5’- TCATCTGTTAGCTTTTCCCCG -3’
57 NM_031969.3
STIM1 F: 5’- ACAAGCTTATCAGCGTGGAG -3’
R: 5’- ACTTCCGGAAAGTCTCCTCA -3’
57 NM_001108496.2
VDAC1 F: 5’- AACAGTAACACTCGCTTTGG -3’
R: 5’- TTGACGTTCTTGCCATCCAG -3’
57 NM_031353.2
MCU F: 5’- GGGGTGTTTCTCCGACAACT -3’
R: 5’- GGAGGTCTCTCTTTGGTGGC -3’
59 NM_001106398.1
Internal control GAPDH F: 5’- TCCCTCAAGATTGTCAGCAA -3’
R: 5’- AGATCCACAACGGATACATT -3’
58 NM_017008.4