Skip to main content

Table 1 Sequences of primers

From: Synergistic stimulation of osteoblast differentiation of rat mesenchymal stem cells by leptin and 25(OH)D3 is mediated by inhibition of chaperone-mediated autophagy

Gene Forward (5′–3′) Reverse (5′–3′)
Megalin ACAACTCGGATGAACGGGAC AGTAGGTGCCGTTGGGAAAG
ALP AGATGGATGAGGCCATCGGA CCAAACGTGAAAACGTGGGA
COL1A1 CACTGCAAGAACAGCGTAGC AAGTTCCGGTGTGACTCGTG
RUNX2 CAGACCAGCAGCACTCCATA AGACTCATCCATTCTGCCGC
OSX GGTCCTGGCAACACTCCTAC AAGAGGTGGGGTGCTGGATA
OSP GAGACCATGCAGAGAGCGAG TTGACCTCAGTCCGTAAGCC
LAMP2A AAGAGCAGGTGGTTTCCGTG ATGGGCACAAGGAAGTTGTCT
HSC70 CTCCATTACCCGTGCTCGAT GAACCACCCACCAGGACAAT
LepR TTGGTCCTCTTCTGGAGC CCCCTTGTGGAATCTGGAGTG
β-actin CTCTGTGTGGATTGGTGGCT CGCAGCTCAGTAACAGTCCG
  1. ALP alkaline phosphatase, COL1A1 collagen type I, RUNX2 runt-related transcription factor 2, OSX osterix, OSP osteopontin, LAMP2A lysosomal-associated membrane protein 2A, HSC70 heat-shock cognate 71 kDa protein, LepR leptin receptor