Skip to main content

Table 1 List of primers

From: Identification of stem cell-related subtypes and risk scoring for gastric cancer based on stem genomic profiling

Gene Primer sequence (5′–3′)
SLIT2 Forward: GCACCATTGAAAGAGGAGCA
Reverse: GCTTTCCTTGGGATTGCCTG
SFRP2 Forward: ACCGAGGAAGCTCCAAAGGTA
Reverse: GAGCCACAGCACCGATTTCT
SCRG1 Forward: CATTTCTGGGATGGGAAGGGA
Reverse: GTGGGAAATCAGGAATGGTGTT
MFAP5 Forward: CAGCGTAAGAGGAGAGAGACAC
Reverse: CAGCAAGAAACAGCAGCACCT
EFEMP1 Forward: TGAAATGCAGACTGGCCGAA
Reverse: TCTACAGTTGTGCGTCCCTG
COL8A1 Forward: AAGGAGATGCCCCACTTGC
  Reverse: GGACCTTGTTCCCCTCGTAA
ABCA8 Forward: AAGAACGCAAAACAGACCGC
Reverse: TTTGGCATCAGGGATGTGCT