Skip to main content

Table 1 Primer sequences used for qRT-PCR

From: Graphene oxide-modified silk fibroin/nanohydroxyapatite scaffold loaded with urine-derived stem cells for immunomodulation and bone regeneration

Gene Primer/probe Sequence
ALP Forward ACCACCACGAGAGTGAACCA
Reverse CGTTGTCTGAGTACCAGTCCC
Runx2 Forward CCAACCCACGAATGCACTATC
Reverse TAGTGAGTGGTGGCGGACATAC
OCN Forward CCCCCTCTAGCCTAGGACC
Reverse ACCAGGTAATGCCAGTTTGC
OPN Forward GACGAGCACATCACCTCACA
Reverse GGCTTCAGCACTCTGGTCAT
GAPDH Forward ACAACTTTGGTATCGTGGAAGG
Reverse GCCATCACGCCACAGTTTC