Skip to main content

Table 2 Primer sequences used for qRT-PCR

From: Graphene oxide-modified silk fibroin/nanohydroxyapatite scaffold loaded with urine-derived stem cells for immunomodulation and bone regeneration

Gene Primer/probe Sequence
iNOS Forward ATTCACTCAGCTGTGCATCG
Reverse TCAGGTGGGATTTCGAAGAG
TNF-α Forward GCTCTTCTGTCTACTGAACTTCGG
Reverse ATGATCTGAGTGTGAGGGTCTGG
CD206 Forward GCTTGTAGGAAGGAGGGT
Reverse TCCAGGAAGCCATTTAGT
Arg-1 Forward CTCCAAGCCAAAGTCCTTAGAG
Reverse AGGAGCTGTCATTAGGGACATC
GAPDH Forward CTGCACCACCAACTGCTTAG
Reverse GTCTGGGATGGAAATTGTGA