Skip to main content

Table 1 Primer list

From: TM9SF4 is a novel regulator in lineage commitment of bone marrow mesenchymal stem cells to either osteoblasts or adipocytes

Name Sequence
Acp5 F: GCAGTATCTTCAGGACGAGAAC; R: TCCATAGTGAAACCGCAAGTAG
Adn F: CATGCTCGGCCCTACATGG; R: CACAGAGTCGTCA TCCGTCAC
Alp F: AACCCAGACACAAGCATTCC; R: GCCTTTGAGGTTTTTGGTCA
Bmp2 F: ATCTGTACCGCAGGCACTCA; R: GGCCGTTTTCCCACTCATCT
Cebpb F: GCAAGAGCCGCGACAAG; R: GGCTCGGGCAGCTGCTT
Ctsk F: CTTAGTCTTCCGCTCACAGTAG; R: ACTTGAACACCCACATCCTG
Fabp4 F: TCACCATCACCTATGGACCCA; R: TCCAGTTCGCACTCCTCCC
Gapdh F: AGGTCGGTGTGAACGGATTTG; R: TGTAGACCATGTAGTTGAGGTCA
Nfatc1 F: CTCGAAAGACAGCACTGGAGCAT; R: CGGCTGCCTTCCGTCTCATAG
Ocn F: CCTGAGTCTGACAAAGCCTTCA; R: GCCGGAGTCTGTTCACTACCTT
Opg F: ACCCAGAAACTGGTCATCAGC; R: CTGCAATACACACACTCATCACT
Opn F: CCCGGTGAAAGTGACTGATT; R: TTCTTCAGAGGACACAGCATTC
Osx F: CCTCTCGACCCGACTGCAGATC; R: AGCTGCAAGCTCTCTGTAACCATGAC
Pparg F: TTGATTTCTCCAGCATTTC; R: TGATCGCACTTTGGTATT
Runx2 F: GAATGGCAGCACGCTATTAAATCC; R: GCCGCTAGAATTCAAAACAGTTGG
Src F: ATGTGGAGCGGATGAACTATG; R: GGCTGTGTATTCGTTGTCTTC
Tm9sf4 F: GGAGTCGCGCCAATCAATTTC; R: GGCAGAAGGGCAATGAGTAGT
Wnt1 F: GGTTTCTACTACGTTGCTACTGG; R: GGAATCCGTCAACAGGTTCGT
Wnt2 F: TCCCAGATTCCAACAACCCAG; R: AACTGATGGGACAGTGAGGAA
Wnt3 F: TGTGTCCAAGCTGCCTCTAC; R: GAACAACAGAAAGGGGCGTG
Wnt8a F: GCCTATCTGACCTACACCGC; R: GCTCTGGCATCCTTCCCTTT
Wnt8b F: GGTATCTATCCCTCCCGCCT; R: TCCAGCATTGAGCGACCATT
Wnt10a F: TTGACATTCCTCCGCTCACC; R: TAGTTTTCTTCCCCGGTGCC
Wnt10b F: CCCTCCCTTTTACCCTCCCT; R: CGGGAAGTTTAAGGCCCAGA