Skip to main content

Table 1 Primers used for qPCR

From: Nanog/NFATc1/Osterix signaling pathway-mediated promotion of bone formation at the tendon–bone interface after ACL reconstruction with De-BMSCs transplantation

Gene Forward primer Reverse primer Annealing (°C)
GAPDH CTCAAGATTGTCAGCAACGCA TTGGGGGTGGGCACACGGAAG 55
Nanog CCTGTGATTTGTGGGCCTGA CTCTGCAGAAGTGGGTTGTTTG 55
OCN GCCCTCACTCTTGTCGCCC GGCTCGCTTCACCACCTCG 55
Col1A1 GCCATCAAGGTCTTCTGCG GAACTGGAAGCCATCGGTC 55
NFATc1 CGTTCTCTCCAACACCAAGG CTTCTCCACAAGGGGCAGTT 55
Osterix TCAACCTCCACTGAACCCC CCTGGTTGTAGGAGGTGGGG 55
OPN CCTGGTTGTAGGAGGTGGGG AGGACATAGCATTCTGCGGTG 55
  1. GAPDH glyceraldehyde 3-phosphate dehydrogenase, OCN osteocalcin, COL1A1 α1 chain of type I collagen, NFATc1 nuclear factor of activated T-cells c1, OPN osteopontin