Skip to main content

Table 2 Primers for miRNA real-time polymerase chain reaction

From: Extracellular vesicles from adipose-derived stem cells promote microglia M2 polarization and neurological recovery in a mouse model of transient middle cerebral artery occlusion

miRNA Primer
mmu-miR-93-3p CCACTGCTGAGCTAGCACTTCCCG
mmu-miR-106b-5p CGCGCTAAAGTGCTGACAGTGCAGAT
mmu-miR-128-3p CGCCGTCACAGTGAACCGGTCTCTTT
mmu-miR-144-3p GCGGCGCGCGTACAGTATAGATGATG
mmu-miR-146a-5p GCGCGTGAGAACTGAATTCCATGGGT
mmu-miR-200a-3p GCCGCGCTAACACTGTCTGGTAACGAT
mmu-miR-200b-3p GCCGCGCGTAATACTGCCTGGTAATGA
mmu-miR-200c-3p GCGCGTAATACTGCCGGGTAATGATGG
mmu-miR-223-3p GCGCGCTGTCAGTTTGTCAAATACCCC
mmu-miR-345-5p CGCTGACCCCTAGTCCAGTGCTT
mmu-miR-363-3p CGCGCGAATTGCACGGTATCCATCTGT
mmu-miR-376a-3p GCCGCGATCGTAGAGGAAAATCCACGT
mmu-miR-429-3p GCGCGCTAATACTGTCTGGTAATGCCG
mmu-miR-451a GCGCGCGAAACCGTTACCATTACTGA