Skip to main content

Table 1 List of primer sequences used in this study

From: Functional tissue-engineered microtissue formed by self-aggregation of cells for peripheral nerve regeneration

Target genes Forward primer (5′–3′) Reverse primer (5′–3′) Annealing temperature (°C)
GAPDH ATGGTGAAGGTCGGTGTGAACG TTACTCCTTGGAGGCCATGTAG 55–62
BDNF TGGAACTCGCAATGCCGAACTAC TCCTTATGAACCGCCAGCCAATTC 57
VEGF GGCTCACTTCCAGAAACACG GTGCTCTTGCAGAATCTAGTGG 55
IL-4 CAAGGAACACCACGGAGAACGAG CTTCAAGCACGGAGGTACATCACG 56
IL-10 CTGCTCTTACTGGCTGGAGTGAAG TGGGTCTGGCTGACTGGGAAG 56
IL-13 CTCGCTTGCCTTGGTGGTCTTG GCACAGGGAAGTCTTCTGGTCTTG 56
  1. GAPDH glyceraldehyde 3-phosphate dehydrogenase, BDNF brain-derived neurotrophic factor, VEGF vascular endothelial growth factor, IL-4 interleukin-4, IL-10 interleukin-10, IL-13 interleukin-13