Skip to main content

Table 1 Primer sequences

From: Optimization of human umbilical cord blood-derived mesenchymal stem cell isolation and culture methods in serum- and xeno-free conditions

Gene Lineage Primer Primer sequence
ALP Osteocyte Forward primer CCCGTGGCAACTCTATCTT
ALP Osteocyte Reverse primer AGTCCACCATGGAGACATTC
PTH-R Osteocyte Forward primer TGAACGGGAGGTGTTTGA
PTH-R Osteocyte Reverse primer GGTGCATGTGGATGTAGTTG
COL I Osteocyte Forward primer CCTGTCTGCTTCCTGTAAACTC
COL I Osteocyte Reverse primer GTTCAGTTTGGGTTGCTTGTC
PPARg Adipocyte Forward primer CCCTTCACTACTGTTGACTTCTC
PPARg Adipocyte Reverse primer TGCAGGCTCCACTTTGATT
Leptin Adipocyte Forward primer CCAGGATCAATGACATTTCACAC
Leptin Adipocyte Reverse primer CATACTGGTGAGGATCTGTTGG
Sox9 Chondrocyte Forward primer AACAAGCCGCACGTCAA
Sox9 Chondrocyte Reverse primer TCTCGCTCTCGTTCAGAAGT
COL II Osteocyte Forward primer ACACTCAAGTCCCTCAACAA
COL II Osteocyte Reverse primer GTCAATCCAGTAGTCTCCACTC
GAPDH Housekeeping genes Forward primer GGTGTGAACCATGAGAAGTATGA
GAPDH Housekeeping genes Reverse primer GAGTCCTTCCACGATACCAAAG